研究者詳細 - 洪　実

論文 - 洪　実

分割表示 162 件中 141 - 160 件目／全件表示 >>

A systematic molecular genetic approach to study mammalian germline development

Abe Kuniya, Ko Minoru S H, Macgregor Grant R.

International Journal of Developmental Biology 42 （ 7 ） 1051 - 1065 1998年

ISSN 0214-6282

It is difficult to study gene expression in mammalian embryonic germ cells as PGCs constitute only a minor proportion of the mouse embryo. We have overcome this problem by using a novel combination of established molecular and transgenic approaches. A line of mice has been generated in which the cells of the germ lineage express the β-galactosidase reporter gene during embryogenesis. Using this line, germ cells have been purified to near homogeneity from embryos at discrete stages during germline development by use of a stain for β-gal activity and a fluorescence activated cell sorter. Subsequently, cDNA libraries have been constructed from each germ cell population using a modified lone-linker PCR strategy. These combined cDNA libraries represent genes expressed in PGCs during mammalian germline development. To facilitate a molecular genetic approach to studying mammalian germline development, these cDNA libraries will be pooled to form an arrayed, addressed reference embryonic germ cell cDNA library. In parallel with large- scale cDNA sequencing efforts, genes that are differentially expressed in germ cells will be identified by screening the reference library with probes generated by subtractive hybridization. Complementary DNAs identified using this approach will be analyzed by sequencing, database comparison, genomic mapping and in situ hybridization to ascertain the potential functional importance of each gene to germline development. In addition to providing a wealth of novel information regarding patterns of gene expression during mammalian germline development, these results will form the basis for future experiments to determine the function of these genes in this process.

The Tabby phenotype is caused by mutation in a mouse homologue of the EDA gene that reveals novel mouse and human exons and encodes a protein (ectodysplasin-A) with collagenous domains

Srivastava Anand K., Pispa Johanna, Hartung Andrew J., Du Yangzhu, Ezer Sini, Jenks Ted, Shimada Tokihiko, Pekkanen Maija, Mikkola Marja L., Ko Minoru S H, Thesleff Irma, Kere Juha, Schlessinger David

Proceedings of the National Academy of Sciences of the United States of America 94 （ 24 ） 13069 - 13074 1997年11月

ISSN 0027-8424

Mouse Tabby (Ta) and X chromosome-linked human EDA share the features of hypoplastic hair, teeth, and eccrine sweat glands. We have cloned the T(a) gene and find it to be homologous to the EDA gene. The gene is altered in two Ta alleles with a point mutation or a deletion. The gene is expressed in developing teeth and epidermis; no expression is seen in corresponding tissues from Ta mice. Ta and EDA genes both encode alternatively spliced forms; novel exons now extend the 3' end of the EDA gene. All transcripts recovered have the same 5' exon. The longest Ta cDNA encodes a 391-residue transmembrane protein, ectodysplasin-A, containing 19 Gly-Xaa-Yaa repeats. The isoforms of ectodysplasin-A may correlate with differential roles during embryonic development.

Access to Document (DOI)

Differential expression pattern of XqPAR-linked genes SYBL1 and IL9R correlates with the structure and evolution of the region

D'Esposito Maurizio, Matarazzo Maria Rosaria, Ciccodicola Alfredo, Strazzullo Maria, Mazzarella Richard, Quaderi Nandita A., Fujiwara Hiroyuki, Ko Minoru S H, Rowe Lucy B., Ricco Angela, Archidiacono Nicoletta, Rocchi Mariano, Schlessinger David, D'Urso Michele

Human Molecular Genetics 6 （ 11 ） 1917 - 1923 1997年10月

ISSN 0964-6906

The recently discovered second pseudoautosomal region (XqPAR) contains at least two genes, IL9R and SYBL1. Recent findings show that, like XpPAR genes, IL9R escapes X inactivation and its Y allele is also expressed, but SYBL1 seems to act like an X-linked gene, expressed from the active X chromosome but not from the inactive X or Y. Here we show that differences are also seen in the evolution of the sex chromosome locations of IL9R and SYBL1, IL9R is known to be autosomal in mice, and is X-linked only in primates. SYBL1, however, has been found to be on the X chromosome in all mammals tested, from marsupials to humans. Both genes were duplicated on the Y homologue of the terminal portion of the X chromosome during the evolution of Homo sapiens from other higher primates. The inactivation pattern of SYBL1 may be correlated with its longer history of X linkage, and at a more centromeric chromosomal position during evolution; the more recent X linkage and more telomeric position of the IL9R gene may explain its autosomal, 'uninactivated' transcriptional status.

Access to Document (DOI)

Basal cell carcinoma occurring in multiple familial trichoapithelloma

Harada H., Hashimoto K., Toi Y., Yotsumoto S., Ko M. S H

Archives of Dermatology 133 （ 5 ） 666 - 667 1997年

ISSN 0003-987X

Cloning and expression analyses of mouse dystroglycan gene

Yotsumoto Shinichi, Fujiwara Hiroyuki, Horton Joseph H., Mosby Tracy A., Wang Xueqian, Cui Yushun, Ko Minoru S H

Human Molecular Genetics 5 （ 9 ） 1259 - 1267 1996年09月

ISSN 0964-6906

While constructing a catalog of mouse cDNAs which are expressed in the maternal-fetal interface during the peri-implantation period, we encountered a 1.6 kb cDNA clone showing a strong sequence similarity to the 3' untranslated region of the human dystroglycan gene. We cloned an additional 1.7 kb cDNA by reverse transcriptase-PCR (RT-PCR) and confirmed that this is a true mouse homolog of human dystroglycan cDNA by sequence analyses, Southern blotting, and genetic mapping of this gene on the distal region of mouse chromosome 9. Although it is well established that dystroglycan, a transmembrane protein, plays an important role in muscle tissues by bridging intracellular dystrophin to the laminin in the extracellular matrix, its role in non-muscle tissues remains elusive. To further investigate the role of the dystroglycan gene at the peri-implantation stage, we analyzed the expression patterns of this gene by in situ hybridization, which revealed that this gene is specifically expressed in decidual cells, especially in the cells surrounding the implantation site at 6.5, 7.5, and 8.5 day post conception (p.c.) stages, but not expressed in non-pregnant endometrial cells of uterus nor in the decidua at 12.5 day p.c. Further analyses by RT-PCR confirmed that the amount of dystroglycan mRNA in 8.5 day p.c. decidua was indeed 100-fold higher than that of non-pregnant uterus and 12.5 day p.c. mature placenta. These results suggest that dystroglycan may work as a mediator for adhesion between decidual cells themselves or between decidual cells and trophoblast cells, and provide a structural and functional support for maintaining pregnancy at its early stage.

Access to Document (DOI)

Expression of aryl hydrocarbon receptor mRNA in porcine retina

Singh A. K., Ko M. S H, Shichi H.

Investigative Ophthalmology and Visual Science 37 （ 3 ） 1996年02月

ISSN 0146-0404

Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCR^TM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.

The gene for multiple familial trichoepithelioma maps to chromosome 9p21

Harada Hiroshi, Hashimoto Ken, Ko Minoru S H

Journal of Investigative Dermatology 107 （ 1 ） 41 - 43 1996年

ISSN 0022-202X

Multiple familial trichoepithelioma (MFT) is an autosomal dominant skin disease characterized by the presence of many small tumors predominantly on the face. To map the causative gene, we performed linkage analysis with microsatellite markers in three American families. We found a significant linkage of a gene for MFT to chromosome 9p21. The maximum combined lod score was 3.31 at D9S171 at θ = 0. The disease locus was defined to a 4-cM region between IFNA and D9S126. Because several tumor suppressor genes including p16 and p15 have been mapped to this region, the gene for MFT may also be a tumor suppressor.

Toward a Whole cDNA Catalog

Takahashi Naomi, Ko Minoru S H

Genomics 23 （ 1 ） 202 - 210 1994年09月

ISSN 0888-7543

The construction of a cDNA library containing all genes without redundancy is one of the major technical challenges for biology. Toward this goal, we have developed an equalized (normalized) cDNA library from mRNA pools derived from mouse embryos that cover the entire period of mouse ontogenesis. Colony hybridization analyses with 11 genes showed the reduction of abundance variation from at least 6000-fold in the unequalized S-library to ∼33-fold in the EIII-library, which was constructed after three cycles of equalization procedure. Limiting dilution PCR analyses with 26 tissue-specific genes showed the reduction of abundance variation from at least ∼1,000,000-fold in the S-cDNA mixture to ∼100-fold in the EIII-cDNA mixture. Based on these analyses, we estimate that at least 15,000 independent cDNA clones are included with little redundancy in the EIII-cDNA library. This will be a useful resource for mouse biology as well as the mouse genome project. © 1994 Academic Press. All rights reserved.

Access to Document (DOI)

Genetic mapping of 40 cDNA clones on the mouse genome by PCR

Ko M. S H, Wang X., Horton J. H., Hagen M. D., Takahashi N., Maezaki Y., Nadeau J. H.

Mammalian Genome 5 （ 6 ） 349 - 355 1994年06月

ISSN 0938-8990

We recently proposed a new PCR-based genetic marker assay for the mouse genome that exploits sequence differences in the 3′-untranslated region (UTR) of cDNAs between different mouse strains, called "biallelic polymorphic expressed sequence tags (bESTs)." The specific use of 3′-UTR has several advantages: (1) frequent sequence polymorphism between different mouse strains, (2) most commonly uninterrupted by introns, (3) usually unique sequence even among closely related gene family members. In this paper, we identify additional genetic loci defined by bEST and determine their location on the mouse genetic map by using interspecific backross mapping panels between C57BL/6J and Mus spretus. Of 136 markers tested, 86 produced unique PCR products from C57BL/6J and M. spretus genomic DNAs. We then sequenced these 86 PCR products from C57BL/6J and M. spretus and found that 59 markers have sequence polymorphisms. Of these, we mapped 36 by restriction fragment length polymorphism (RFLP) of the PCR products and 4 by length polymorphism (LP) of the PCR products. We discuss the possibility of a large-scale application of this method for cDNA mapping. © 1994 Springer-Verlag New York Inc.

Access to Document (DOI)

Maps from two interspecific backcross DNA panels available as a community genetic mapping resource

Rowe L. B., Nadeau J. H., Turner R., Frankel W. N., Letts V. A., Eppig J. T., Ko M. S H, Thurston S. J., Birkenmeier E. H.

Mammalian Genome 5 （ 5 ） 253 - 274 1994年05月

ISSN 0938-8990

We established two mouse interspecific backcross DNA panels, one containing 94 N2 animals from the cross (C57BL/6J × Mus spretus)F₁ × C57BL/6J, and another from 94 N2 animals from the reciprocal backcross (C57BL/6J × SPRET/Ei)F₁ × SPRET/Ei. We prepared large quantities of DNA from most tissues of each animal to create a community resource of interspecific backcross DNA for use by laboratories interested in mapping loci in the mouse. Initial characterization of the genetic maps of both panels has been completed. We used MIT SSLP markers, proviral loci, and several other sequence-defined genes to anchor our maps to other published maps. The BSB panel map (from the backcross to C57BL/6J) contains 215 loci and is anchored by 45 SSLP and 32 gene sequence loci. The BSS panel map (from the backcross to SPRET/Ei) contains 451 loci and is anchored by 49 SSLP loci, 43 proviral loci, and 60 gene sequence loci. To obtain a high density of markers, we used motif-primed PCR to "fingerprint" the panel DNAs. We constructed two maps, each representing one of the two panels. All new loci can be located with a high degree of certainty on the maps at current marker density. Segregation patterns in these data reveal several examples of transmission ratio distortion and permit analysis of the distribution of crossovers on individual chromosomes. © 1994 Springer-Verlag New York Inc.

Access to Document (DOI)

Simple and robust screening of pooled yeast artificial chromosome libraries by the restriction enzyme digestion of polymerase chain reaction products

Wang X., Qian J., Ko M. S H

Genetic Analysis Techniques and Applications 11 （ 3 ） 63 - 68 1994年

ISSN 1050-3862

The polymerase chain reaction (PCR)-based method for screening pooled yeast artificial chromosome (YAC) libraries was modified by adding a step for the restriction enzyme digestion of the PCR products. This modification significantly increased the reliability of YAC screening and made it possible to identify YAC clones without a cumbersome verification step by colony hybridization and/or Southern blotting. Using this method, we assigned 39 mouse YAC clones to a mouse genetic map with 13 biallelic, polymorphic expressed sequence tags. This method provides a fast, reliable way to identify YAC clones with PCR-based sequence-tagged sites.

Access to Document (DOI)

Optimized conditions for cycle sequencing of PCR products

Horton J. H., Hagen M. D., Ko M. S H

PCR Methods and Applications 3 （ 6 ） 359 - 360 1994年

ISSN 1054-9803

The Short 3′-End Region of Complementary DNAs as PCR-Based Polymorphic Markers for an Expression Map of the Mouse Genome

Takahashi Naomi, Ko Minoru S H

Genomics 16 （ 1 ） 161 - 168 1993年04月

ISSN 0888-7543

Ideal markers for a complementary DNA (cDNA) map of the mouse genome should be amplifiable by the polymerase chain reaction (PCR) and they should be polymorphic for genetic mapping, as well as unique for physical mapping. In our search for such markers, we did comparative sequencing of PCR-amplified genomic DNAs derived from 15 inbred strains and found that about 250 bp of the 3′-end region (3′-ER) of cDNAs, which is the sequence immediately upstream from the poly(A) tail, was polymorphic enough to distinguish the allele of a laboratory strain from that of a wild strain (Mus spretus) in 14 of 22 cDNAs tested. Specifically, in 9 of these 14 cDNAs, each allele was identified by the restriction fragment length polymorphism. This data indicates that about 65% of the 3′-ERs of cDNAs can be automatically transformed into PCR-based genetic markers named "biallelic polymorphic expressed sequence tags (bESTs)." These markers can be easily and precisely mapped by typing of the panels of interspecific backcrosses. Because a large number of bEST markers can be efficiently obtained by a single-run automated sequencing of randomly selected cDNAs, these markers will greatly facilitate the construction of high-resolution genetic and physical maps of expressed sequences of the mouse genome. © 1993 Academic Press. All rights reserved.

Access to Document (DOI)

An equalized cDNA library and its application

Ko M. S.

Tanpakushitsu kakusan koso. Protein, nucleic acid, enzyme 38 （ 3 ） 420 - 428 1993年02月

ISSN 0039-9450

Induction mechanism of a single gene molecule

Ko Minoru S H

BioEssays 14 （ 5 ） 341 - 346 1992年

ISSN 0265-9247

A new field of gene expression regulation research is emerging that has previously been overlooked. This new area is concerned with distinguishing the expression of a single gene from the averaged expression of many gene copies within the cell population. This paper reviews research focused on individual genes in inducible gene expression systems. The main experimental strategy is to measure the gene expression level of a single cell containing a single reporter gene molecule. In contrast to the commonly held belief, gene induction is found to be stochastic under certain conditions. The possible mechanisms and implications are discussed.

A stochastic model for gene induction

Ko Minoru S H

Journal of Theoretical Biology 153 （ 2 ） 181 - 194 1991年11月

ISSN 0022-5193

Expression levels of individual copies of an inducible gene have been presumed to be identical to the averaged level of many copies and to change in a smooth and predictable way according to the concentration of an inducing molecule. However, our recent experiments using a steroid-inducible system showed that the expression levels of individual copies are very heterogeneous and do not necessarily coincide with the averaged expression level of many copies (Ko et al., 1990, EMBO J. 9, 2835-2842). To explain this result, I present a stochastic model for gene induction here and its analysis using computer simulation. Stochasticity in the model is derived from the randomness corresponding to the random timing of molecular collisions and dissociations between transcription factors and a gene copy, since at any instant each copy is thought to be either "switched on" by having a transcription complex bound to it, or "switched off' by not having a transcription complex bound. This model can produce two types of gene induction that depend on the stability of the transcription complex on the regulatory region of the gene. An unstable transcription complex causes a homogeneous level of gene induction among individual copies, while a stable transcription complex causes a heterogeneous level. Since the recent consensus formed by in vitro transcription experiments is that the transcription complex is generally very stable, the latter case (the non-deterministic one) is highly possible. Since typical eukaryotic cells have just two copies for any gene in a single cell, this possibility of heterogeneous gene induction indicates that the phenotypes of individual cells cannot be precisely determined by just environmental signals, such as inducers. This may prompt us to reconsider many problems related to gene induction, including morphogenesis. © 1991 Academic Press Limited.

Access to Document (DOI)

An 'equalized cDNA library' by the reassociation of short double-stranded cDNAs

Ko Minoru S H

Nucleic Acids Research 18 （ 19 ） 5705 - 5711 1990年10月

ISSN 0305-1048

The total number of genes in higher organisms is estimated to be under one hundred thousand. However, constructing a cDNA library containing a full set of genes expressed throughout the life time of an organism, without redundancy, is a major challenge for modern biology. Towards this goal, I have tried to make a library of mouse fibroblastoid LtK^- cells with nearly equal representations of cDNA clones. Double-stranded cDNAs (ds-cDNAs) are synthesized from mRNA using an oligo(dT)-Notl primer. After shearing to 200-400 bp, a synthetic linker-primer, which has one blunt and one sticky end and an internal EcoRI site, is ligated to the cDNAs. The cDNAs are amplified by the polymerase chain reaction (PCR) using the ligated linker-primer sequence. After denaturation and reassociation of the ds-cDNAs, and isolation of single-stranded cDNAs (ss-cDNAs) by hydroxylapatite chromatography, the ss-cDNAs are again amplified by PCR. The cDNAs are digested with EcoRI and Notl, and inserted into a plasmid vector. Colony hybridization with eight probes of different abundance showed a reduction in 'abundance variation' from at least 20,000-fold in the original library to 40-fold in the library constructed after three cycles of equalization. This indicates the usefulness of the current procedure for making equalized cDNA libraries.

Unbiased amplification of a highly complex mixture of DNA fragments by 'lone linker'-tagged PCR

Ko M. S H, Ko S. B H, Takahashi N., Nishiguchi K., Abe K.

Nucleic Acids Research 18 （ 14 ） 4293 1990年07月

ISSN 0305-1048

Access to Document (DOI)

The dose dependence of glucocorticoid-inducible gene expression results from changes in the number of transcriptionally active templates

Ko Minoru S H, Nakauchi Hiromitsu, Takahashi Naomi

EMBO Journal 9 （ 9 ） 2835 - 2842 1990年

ISSN 0261-4189

Glucocorticoid hormones induce the transcription of genes having glucocorticoid response elements in a dose dependent manner. To determine whether this dose dependence represents a response of individual templates or of the mass of templates, we introduced a bacterial β-galactosidase gene linked to the glucocorticoid-indudble enhancer/promoter of the mouse mammary tumor virus (MTV) into Ltk^- cells and obtained stable transformants containing a single or a few templates per cell. Visual inspection and flow cytometry analysis by enzyme histochemistry assay for β-galactosidase revealed that individual cells showed very heterogeneous β-galactosidase activity after 48 h induction with dexamethasone. When the glucocorticoid concentration was increased, an increasing cell population producing β-galactosidase was observed. These phenomena were probably not due to heterogeneity of template copy number or to a predetermined cellular state among individual cells, since cells forming a single small colony gave similar results. This was also supported by data showing that recloned cells retained both their responsiveness to the glucocorticoid hormone and their digestion pattern in Southern blotting analyses. These results indicate that the dose dependent increase of glucocorticoid-inducible gene expression is caused by an increase in the number of transcriptionally active templates.

An auto-inducible vector conferring high glucocorticoid inducibility upon stable transformant cells

Ko Minoru S H, Naomi Takahashi, Norifumi Sugiyama, Toshiya Takano

Gene 84 （ 2 ） 383 - 389 1989年12月

ISSN 0378-1119

A new gene expression system in mammalian cells was developed by using the glucocorticoid receptor (GR) as an inducible positive feedback factor. Mouse Ltk^- cells were transfected with plasmids carrying the GR-encoding gene and the lacZ reporter gene, both of which were fused with the glucocorticoid-inducible enhancer/promotor of the mouse mammary tumor virus (MTV). The GR gene was first induced to supply the receptor protein, which further induced the expression of both GR and reporter genes. Stable transformants induced with dexamethasone, a synthetic glucocorticoid hormone, demonstrated β-galactosidase activity 60-140-fold higher than uninduced controls. Similarly, the human α-interferon-encoding gene fused with the MTV enhancer/promoter was induced more than 12 000-fold. This system allowed us to increase the expression of the reporter or target genes without augmenting basal levels of expression significantly, and may be useful to investigate the unknown function of a cloned gene, particularly when the gene product of interest is cytotoxic or growth-inhibiting. © 1989.

Access to Document (DOI)

　前のページ - 次のページ　

洪 実

論文 - 洪 実

洪　実

論文 - 洪　実