研究者詳細 - 洪　実

論文 - 洪　実

分割表示 >> ／全件表示 162 件中 1 - 162 件目

SCODE

Matsumoto Hirotaka, Kiryu Hisanori, Furusawa Chikara, Ko Minoru S.H., Ko Shigeru B.H., Gouda Norio, Hayashi Tetsutaro, Nikaido Itoshi

Bioinformatics 33 （ 15 ） 2314 - 2321 2017年08月

ISSN 1367-4803

Motivation: The analysis of RNA-Seq data from individual differentiating cells enables us to reconstruct the differentiation process and the degree of differentiation (in pseudo-time) of each cell. Such analyses can reveal detailed expression dynamics and functional relationships for differentiation. To further elucidate differentiation processes, more insight into gene regulatory networks is required. The pseudo-time can be regarded as time information and, therefore, single-cell RNASeq data are time-course data with high time resolution. Although time-course data are useful for inferring networks, conventional inference algorithms for such data suffer from high time complexity when the number of samples and genes is large. Therefore, a novel algorithm is necessary to infer networks from single-cell RNA-Seq during differentiation. Results: In this study, we developed the novel and efficient algorithm SCODE to infer regulatory networks, based on ordinary differential equations. We applied SCODE to three single-cell RNASeq datasets and confirmed that SCODE can reconstruct observed expression dynamics. We evaluated SCODE by comparing its inferred networks with use of a DNaseI-footprint based network. The performance of SCODE was best for two of the datasets and nearly best for the remaining dataset. We also compared the runtimes and showed that the runtimes for SCODE are significantly shorter than for alternatives. Thus, our algorithm provides a promising approach for further singlecell differentiation analyses.

Access to Document (DOI)

Neural differentiation of human embryonic stem cells induced by the transgene-mediated overexpression of single transcription factors

Matsushita Misako, Nakatake Yuhki, Arai Itaru, Ibata Keiji, Kohda Kazuhisa, Goparaju Sravan K., Murakami Miyako, Sakota Miki, Chikazawa-Nohtomi Nana, Ko Shigeru B.H., Kanai Takanori, Yuzaki Michisuke, Ko Minoru S.H.

Biochemical and Biophysical Research Communications 2017年05月

ISSN 0006-291X

Pluripotent human embryonic stem cells (hESCs) can differentiate into multiple cell lineages, thus, providing one of the best platforms to study molecular mechanisms during cell differentiation. Recently, we have reported rapid and efficient differentiation of hESCs into functional neurons by introducing a cocktail of synthetic mRNAs encoding five transcription factors (TFs): NEUROG1, NEUROG2, NEUROG3, NEUROD1, and NEUROD2. Here we further tested a possibility that even single transcription factors, when expressed ectopically, can differentiate hESCs into neurons. To this end, we established hESC lines in which each of these TFs can be overexpressed by the doxycycline-inducible piggyBac vector. The overexpression of any of these five TFs indeed caused a rapid and rather uniform differentiation of hESCs, which were identified as neurons based on their morphologies, qRT-PCR, and immunohistochemistry. Furthermore, calcium-imaging analyses and patch clamp recordings demonstrated that these differentiated cells are electrophysiologically functional. Interestingly, neural differentiations occurred despite the cell culture conditions that rather promote the maintenance of the undifferentiated state. These results indicate that over-expression of each of these five TFs can override the pluripotency-specific gene network and force hESCs to differentiate into neurons.

Access to Document (DOI)

Rapid differentiation of human pluripotent stem cells into functional neurons by mRNAs encoding transcription factors

Goparaju Sravan Kumar, Kohda Kazuhisa, Ibata Keiji, Soma Atsumi, Nakatake Yukhi, Akiyama Tomohiko, Wakabayashi Shunichi, Matsushita Misako, Sakota Miki, Kimura Hiromi, Yuzaki Michisuke, Ko Shigeru B H, Ko Minoru S H

Scientific Reports 7 2017年02月

ISSN 2045-2322

Efficient differentiation of human pluripotent stem cells (hPSCs) into neurons is paramount for disease modeling, drug screening, and cell transplantation therapy in regenerative medicine. In this manuscript, we report the capability of five transcription factors (TFs) toward this aim: NEUROG1, NEUROG2, NEUROG3, NEUROD1, and NEUROD2. In contrast to previous methods that have shortcomings in their speed and efficiency, a cocktail of these TFs as synthetic mRNAs can differentiate hPSCs into neurons in 7 days, judged by calcium imaging and electrophysiology. They exhibit motor neuron phenotypes based on immunostaining. These results indicate the establishment of a novel method for rapid, efficient, and footprint-free differentiation of functional neurons from hPSCs.

Access to Document (DOI)

Epigenetic Manipulation Facilitates the Generation of Skeletal Muscle Cells from Pluripotent Stem Cells

Akiyama Tomohiko, Wakabayashi Shunichi, Soma Atsumi, Sato Saeko, Nakatake Yuhki, Oda Mayumi, Murakami Miyako, Sakota Miki, Chikazawa-Nohtomi Nana, Ko Shigeru B.H., Ko Minoru S.H.

Stem Cells International 2017 2017年

Human pluripotent stem cells (hPSCs) have the capacity to differentiate into essentially all cell types in the body. Such differentiation can be directed to specific cell types by appropriate cell culture conditions or overexpressing lineage-defining transcription factors (TFs). Especially, for the activation of myogenic program, early studies have shown the effectiveness of enforced expression of TFs associated with myogenic differentiation, such as PAX7 and MYOD1. However, the efficiency of direct differentiation was rather low, most likely due to chromatin features unique to hPSCs, which hinder the access of TFs to genes involved in muscle differentiation. Indeed, recent studies have demonstrated that ectopic expression of epigenetic-modifying factors such as a histone demethylase and an ATP-dependent remodeling factor significantly enhances myogenic differentiation from hPSCs. In this article, we review the recent progress for in vitro generation of skeletal muscles from hPSCs through forced epigenetic and transcriptional manipulation.

Access to Document (DOI)

Transient ectopic expression of the histone demethylase JMJD3 accelerates the differentiation of human pluripotent stem cells

Akiyama Tomohiko, Wakabayashi Shunichi, Soma Atsumi, Sato Saeko, Nakatake Yuhki, Oda Mayumi, Murakami Miyako, Sakota Miki, Chikazawa-Nohtomi Nana, Ko Shigeru B H, Ko Minoru S H

Development (Cambridge) 143 （ 20 ） 3674 - 3685 2016年10月

ISSN 0950-1991

Harnessing epigenetic regulation is crucial for the efficient and proper differentiation of pluripotent stem cells (PSCs) into desired cell types. Histone H3 lysine 27 trimethylation (H3K27me3) functions as a barrier against cell differentiation through the suppression of developmental gene expression in PSCs. Here, we have generated human PSC (hPSC) lines in which genome-wide reduction of H3K27me3 can be induced by ectopic expression of the catalytic domain of the histone demethylase JMJD3 (called JMJD3c). We found that transient, forced demethylation of H3K27me3 alone triggers the upregulation of mesoendodermal genes, even when the culture conditions for the hPSCs are not changed. Furthermore, transient and forced expression of JMJD3c followed by the forced expression of lineage-defining transcription factors enabled the hPSCs to activate tissue-specific genes directly. We have also shown that the introduction of JMJD3c facilitates the differentiation of hPSCs into functional hepatic cells and skeletal muscle cells. These results suggest the utility of the direct manipulation of epigenomes for generating desired cell types from hPSCs for cell transplantation therapy and platforms for drug screenings.

Access to Document (DOI)

Zscan4 is expressed specifically during late meiotic prophase in both spermatogenesis and oogenesis

Ishiguro Kei ichiro, Monti Manuela, Akiyama Tomohiko, Kimura Hiromi, Chikazawa-Nohtomi Nana, Sakota Miki, Sato Saeko, Redi Carlo Alberto, Ko Shigeru B H, Ko Minoru S H

In Vitro Cellular and Developmental Biology - Animal 1 - 12 2016年10月

ISSN 1071-2690

Mouse zinc finger and SCAN domain containing 4 (Zscan4) proteins, which are encoded by multiple copies of Zscan4 genes, are expressed specifically in preimplantation embryos in vivo and embryonic stem (ES) cells in vitro. However, the expression patterns of mouse Zscan4 in vivo have been largely elusive. Here, we show that Zscan4 proteins are expressed in adult ovaries and testes. In ovaries, Zscan4 proteins were detected in germinal vesicle (GV) stage oocytes in antral follicles, indicating that Zscan4 genes are activated during the diplotene/dictyate stage in meiotic prophase I. Remarkably, Zscan4 showed different spatial localization patterns between two distinct GV oocytes, which can be distinguished by global chromatin organization—surrounded nucleolus (SN) and non-surrounded nucleolus (NSN). These spatiotemporal differences in Zscan4 localizations correlated with the transition of RNA polymerase II-mediated transcriptional status during GV oocyte maturation. In testes, Zscan4 proteins were detected in spermatocytes at late pachytene/diplotene stages and in Sertoli cells. These results suggest that Zscan4 may play critical roles during late meiotic prophase in both males and females.

Access to Document (DOI)

Expression analysis of the endogenous Zscan4 locus and its coding proteins in mouse ES cells and preimplantation embryos

Ishiguro Kei ichiro, Nakatake Yuhki, Chikazawa-Nohtomi Nana, Kimura Hiromi, Akiyama Tomohiko, Oda Mayumi, Ko Shigeru B H, Ko Minoru S H

In Vitro Cellular and Developmental Biology - Animal 1 - 12 2016年10月

ISSN 1071-2690

Mouse Zinc finger and SCAN domain containing 4 (Zscan4) is encoded in multiple copies of Zscan4 genes, which are expressed in late two-cell stage preimplantation embryos and in 1–5% of the embryonic stem (ES) cell population at a given time. Due to the highly identical nucleotide sequences of multiple copies of Zscan4 paralogs and pseudogenes in the mouse Zscan4 genomic cluster, previous analyses have been done using exogenous transgenes under the regulation of Zscan4c promoter. In this manuscript, we generated knock-in mouse ES cell lines and mouse lines, in which the expression of endogenous Zscan4c, one of the Zscan4 genes, can be specifically monitored with a green fluorescent protein variant, Emerald. Interestingly, we found that only ∼30% of Zscan4-immunopositive ES cells were Emerald positive, suggesting that even when the Zscan4 locus is active, not all Zscan4 genes are expressed synchronously. We also carried out mass spectrometry of protein complexes associated with endogenous Zscan4 proteins. Taken together, our genetic engineering at an endogenous Zscan4c gene provides the first clue for the expression and function of each gene copy of Zscan4 locus in a physiological context.

Access to Document (DOI)

Induction of specific neuron types by overexpression of single transcription factors

Teratani-Ota Yusuke, Yamamizu Kohei, Piao Yulan, Sharova Lioudmila, Amano Misa, Yu Hong, Schlessinger David, Ko Minoru S H, Sharov Alexei A.

In Vitro Cellular and Developmental Biology - Animal 1 - 13 2016年06月

ISSN 1071-2690

Summary: Specific neuronal types derived from embryonic stem cells (ESCs) can facilitate mechanistic studies and potentially aid in regenerative medicine. Existing induction methods, however, mostly rely on the effects of the combined action of multiple added growth factors, which generally tend to result in mixed populations of neurons. Here, we report that overexpression of specific transcription factors (TFs) in ESCs can rather guide the differentiation of ESCs towards specific neuron lineages. Analysis of data on gene expression changes 2 d after induction of each of 185 TFs implicated candidate TFs for further ESC differentiation studies. Induction of 23 TFs (out of 49 TFs tested) for 6 d facilitated neural differentiation of ESCs as inferred from increased proportion of cells with neural progenitor marker PSA-NCAM. We identified early activation of the Notch signaling pathway as a common feature of most potent inducers of neural differentiation. The majority of neuron-like cells generated by induction of Ascl1, Smad7, Nr2f1, Dlx2, Dlx4, Nr2f2, Barhl2, and Lhx1 were GABA-positive and expressed other markers of GABAergic neurons. In the same way, we identified Lmx1a and Nr4a2 as inducers for neurons bearing dopaminergic markers and Isl1, Fezf2, and St18 for cholinergic motor neurons. A time-course experiment with induction of Ascl1 showed early upregulation of most neural-specific messenger RNA (mRNA) and microRNAs (miRNAs). Sets of Ascl1-induced mRNAs and miRNAs were enriched in Ascl1 targets. In further studies, enrichment of cells obtained with the induction of Ascl1, Smad7, and Nr2f1 using microbeads resulted in essentially pure population of neuron-like cells with expression profiles similar to neural tissues and expressed markers of GABAergic neurons. In summary, this study indicates that induction of transcription factors is a promising approach to generate cultures that show the transcription profiles characteristic of specific neural cell types.

Access to Document (DOI)

Generation and gene expression profiling of 48 transcription-factor-inducible mouse embryonic stem cell lines

Yamamizu Kohei, Sharov Alexei A., Piao Yulan, Amano Misa, Yu Hong, Nishiyama Akira, Dudekula Dawood B., Schlessinger David, Ko Minoru S H

Scientific Reports 6 2016年05月

Mouse embryonic stem cells (ESCs) can differentiate into a wide range-and possibly all cell types in vitro, and thus provide an ideal platform to study systematically the action of transcription factors (TFs) in cell differentiation. Previously, we have generated and analyzed 137 TF-inducible mouse ESC lines. As an extension of this "NIA Mouse ESC Bank" we generated and characterized 48 additional mouse ESC lines, in which single TFs in each line could be induced in a doxycycline-controllable manner. Together, with the previous ESC lines, the bank now comprises 185 TF-manipulable ESC lines (>10% of all mouse TFs). Global gene expression (transcriptome) profiling revealed that the induction of individual TFs in mouse ESCs for 48 hours shifts their transcriptomes toward specific differentiation fates (e.g., neural lineages by Myt1 Isl1, and St18; mesodermal lineages by Pitx1, Pitx2, Barhl2, and Lmx1a; white blood cells by Myb, Etv2, and Tbx6, and ovary by Pitx1, Pitx2, and Dmrtc2). These data also provide and lists of inferred target genes of each TF and possible functions of these TFs. The results demonstrate the utility of mouse ESC lines and their transcriptome data for understanding the mechanism of cell differentiation and the function of TFs.

Access to Document (DOI)

Emergence of undifferentiated colonies from mouse embryonic stem cells undergoing differentiation by retinoic acid treatment

Sharova Lioudmila V., Sharov Alexei A., Piao Yulan, Stagg Carole A., Amano Tomokazu, Qian Yong, Dudekula Dawood, Schlessinger David, Ko Minoru S H

In Vitro Cellular and Developmental Biology - Animal 1 - 9 2016年04月

ISSN 1071-2690

Retinoic acid (RA) is one of the most potent inducers of differentiation of mouse embryonic stem cells (ESCs). However, previous studies show that RA treatment of cells cultured in the presence of a leukemia inhibitory factor (LIF) also result in the upregulation of a gene called Zscan4, whose transient expression is a marker for undifferentiated ESCs. We explored the balance between these two seemingly antagonistic effects of RA. ESCs indeed differentiated in the presence of LIF after RA treatment, but colonies of undifferentiated ESCs eventually emerged from these differentiated cells — even in the presence of RA. These colonies, named secondary colonies, consist of three cell types: typical undifferentiated ESCs expressing pluripotency genes such as Pou5f1, Sox2, and Nanog; cells expressing Zscan4; and endodermal-like cells located at the periphery of the colony. The capacity to form secondary colonies was confirmed for all eight tested ESC lines. Cells from the secondary colonies — after transfer to the standard ESC medium — retained pluripotency, judged by their strong alkaline phosphatase (ALP) staining, typical colony morphology, gene expression profile, stable karyotype, capacity to differentiate into all three germ layers in embryoid body formation assays, and successful contribution to chimeras after injection into blastocysts. Based on flow cytometry analysis (FACS), the proportion of Zscan4-positive cells in secondary colonies was higher than in standard ESC colonies, which may explain the capacity of ESCs to resist the differentiating effects of RA and instead form secondary colonies of undifferentiated ESCs. This hypothesis is supported by cell-lineage tracing analysis, which showed that most cells in the secondary colonies were descendents of cells transiently expressing Zscan4.

Access to Document (DOI)

Gene array analysis of neural crest cells identifies transcription factors necessary for direct conversion of embryonic fibroblasts into neural crest cells

Motohashi Tsutomu, Watanabe Natsuki, Nishioka Masahiro, Nakatake Yuhki, Yulan Piao, Mochizuki Hiromi, Kawamura Yoshifumi, Ko Minoru S H, Goshima Naoki, Kunisada Takahiro

Biology Open 5 （ 3 ） 311 - 322 2016年03月

Neural crest cells (NC cells) are multipotent cells that emerge from the edge of the neural folds and migrate throughout the developing embryo. Although the gene regulatory network for generation of NC cells has been elucidated in detail, it has not been revealed which of the factors in the network are pivotal to directing NC identity. In this study we analyzed the gene expression profile of a pure NC subpopulation isolated from Sox10-IRES-Venus mice and investigated whether these genes played a key role in the direct conversion of Sox10-IRES-Venus mouse embryonic fibroblasts (MEFs) into NC cells. The comparative molecular profiles of NC cells and neural tube cells in 9.5-day embryos revealed genes including transcription factors selectively expressed in developing trunk NC cells. Among 25 NC cell-specific transcription factor genes tested, SOX10 and SOX9 were capable of converting MEFs into SOX10-positive (SOX10+) cells. The SOX10+ cells were then shown to differentiate into neurons, glial cells, smooth muscle cells, adipocytes and osteoblasts. These SOX10+ cells also showed limited self-renewal ability, suggesting that SOX10 and SOX9 directly converted MEFs into NC cells. Conversely, the remaining transcription factors, including well-known NC cell specifiers, were unable to convert MEFs into SOX10+ NC cells. These results suggest that SOX10 and SOX9 are the key factors necessary for the direct conversion of MEFs into NC cells.

Access to Document (DOI)

Zygotic Genome Activation Revisited

Ko M. S H

Current Topics in Developmental Biology 2016年

ISSN 0070-2153

Zygotic genome activation (ZGA, a.k.a. zygotic gene activation) is a critical event in development, when the paternally derived genome and maternally derived genome begin to be activated and transcribed after fertilization. Major ZGA occurs at the two-cell stage in mice and the four- to eight-cell stage in human preimplantation embryos. It has been thought that ZGA exists to provide RNAs and proteins supporting embryonic development after supplies stored in oocytes are used up; however, this paradigm does not seem to explain recent findings. For example, many ZGA genes-once activated-are quickly turned off, and thus ZGA forms a transient wave of transcriptional activation. In addition, ZGA genes are not evolutionarily conserved. In this review, we address these issues by focusing on Zscan4 (zinc finger and SCAN domain-containing 4), which was identified for its specific expression in preimplantation embryos during ZGA. Detailed molecular analyses of Zscan4 expression and function have revealed common features of Zscan4-associated events (Z4 events) in mouse embryonic stem cells and ZGA in preimplantation embryos. One feature is a rapid derepression and rerepression of constitutive heterochromatin, which includes pericentromeric major satellites and telomeres, and facultative heterochromatin, which includes retrotransposons and Z4 event-associated genes. We propose that the Z4 event superimposed on ZGA plays a critical role in the maintenance of genome and chromosome integrity in preimplantation embryos by promoting correction of DNA damage and chromosome abnormalities.

Access to Document (DOI)

ExAtlas

Sharov Alexei A., Schlessinger David, Ko Minoru S H

Journal of Bioinformatics and Computational Biology 13 （ 6 ） 2015年12月

ISSN 0219-7200

We have developed ExAtlas, an on-line software tool for meta-analysis and visualization of gene expression data. In contrast to existing software tools, ExAtlas compares multi-component data sets and generates results for all combinations (e.g. all gene expression profiles versus all Gene Ontology annotations). ExAtlas handles both users' own data and data extracted semi-automatically from the public repository (GEO/NCBI database). ExAtlas provides a variety of tools for meta-analyses: (1) standard meta-analysis (fixed effects, random effects, z-score, and Fisher's methods); (2) analyses of global correlations between gene expression data sets; (3) gene set enrichment; (4) gene set overlap; (5) gene association by expression profile; (6) gene specificity; and (7) statistical analysis (ANOVA, pairwise comparison, and PCA). ExAtlas produces graphical outputs, including heatmaps, scatter-plots, bar-charts, and three-dimensional images. Some of the most widely used public data sets (e.g. GNF/BioGPS, Gene Ontology, KEGG, GAD phenotypes, BrainScan, ENCODE ChIP-seq, and protein-protein interaction) are pre-loaded and can be used for functional annotations.

Access to Document (DOI)

Correction of Down syndrome and Edwards syndrome aneuploidies in human cell cultures

洪実

DNA Res. 22 （ 5 ） 331 - 342 2015年10月

研究論文（学術雑誌）, 査読有り

Access to Document (DOI)

Transient bursts of Zscan4 expression are accompanied by the rapid derepression of heterochromatin in mouse embryonic stem cells

洪実

DNA Res. 22 （ 5 ） 307 - 318 2015年10月

研究論文（学術雑誌）

Access to Document (DOI)

ExAtlas: An interactive online tool for meta-analysis of gene expression data

洪実

J Bioinform Comput Biol. 1550019 2015年06月

研究論文（学術雑誌）, 共著, 査読有り

SOX9 accelerates ESC differentiation to three germ layer lineages by repressing SOX2 expression through P21 (WAF1/CIP1)

Yamamizu Kohei, Schlessinger David, Ko Minoru S H

Development (Cambridge) 141 （ 22 ） 4254 - 4266 2014年11月

ISSN 0950-1991

Upon removal of culture conditions that maintain an undifferentiated state, mouse embryonic stem cells (ESCs) differentiate into various cell types. Differentiation can be facilitated by forced expression of certain transcription factors (TFs), each of which can generally specify a particular developmental lineage. We previously established 137 mouseESClines, each of which carried a doxycycline-controllable TF. Among them, Sox9 has unique capacity: its forced expression accelerates differentiation of mouse ESCs into cells of all three germ layers. With the additional use of specific culture conditions, overexpression of Sox9 facilitated the generation of endothelial cells, hepatocytes and neurons from ESCs. Furthermore, Sox9 action increases formation of p21 (WAF1/CIP1), which then binds to the SRR2 enhancer of pluripotency marker Sox2 and inhibits its expression. Knockdown of p21 abolishes inhibition of Sox2 and Sox9-accelerated differentiation, and reduction of Sox2 2 days after the beginning of ESC differentiation can comparably accelerate mouse ESC formation of cells of three germ layers. These data implicate the involvement of the p21-Sox2 pathway in the mechanism of accelerated ESC differentiation by Sox9 overexpression. The molecular cascade could be among the first steps to program ESC differentiation.

Access to Document (DOI)

Chromatin properties of regulatory DNA probed by manipulation of transcription factors

Sharov Alexei A., Nishiyama Akira, Qian Yong, Dudekula Dawood B., Longo Dan L., Schlessinger David, Ko Minoru S H

Journal of Computational Biology 21 （ 8 ） 569 - 577 2014年08月

ISSN 1066-5277

Transcription factors (TFs) bind to DNA and regulate the transcription of nearby genes. However, only a small fraction of TF binding sites have such regulatory effects. Here we search for the predictors of functional binding sites by carrying out a systematic computational screening of a variety of contextual factors (histone modifications, nuclear lamin-bindings, and cofactor bindings). We used regression analysis to test if contextual factors are associated with upregulation or downregulation of neighboring genes following the induction or knockdown of the 9 TFs in mouse embryonic stem (ES) cells. Functional TF binding sites appeared to be either active (i.e., bound by P300, CHD7, mediator, cohesin, and SWI/SNF) or repressed (i.e., with H3K27me3 histone marks and bound by Polycomb factors). Active binding sites mediated the downregulation of nearby genes upon knocking down the activating TFs or inducing repressors. Repressed TF binding sites mediated the upregulation of nearby genes (e.g., poised developmental regulators) upon inducing TFs. In addition, repressed binding sites mediated repressive effects of TFs, identified by the downregulation of target genes after the induction of TFs or by the upregulation of target genes after the knockdown of TFs. The contextual factors associated with functions of DNA-bound TFs were used to improve the identification of candidate target genes regulated by TFs. © Copyright 2014, Mary Ann Liebert, Inc. 2014.

Access to Document (DOI)

Efficient generation of integration-free human induced pluripotent stem cells from keratinocytes by simple transfection of episomal vectors

Piao Yulan, Hung Sandy Shen Chi, Lim Shiang Y., Wong Raymond Ching Bong, Ko Minoru S H

Stem Cells Translational Medicine 3 （ 7 ） 787 - 791 2014年

ISSN 2157-6564

Keratinocytes represent an easily accessible cell source for derivation of human induced pluripotent stem (hiPS) cells, reportedly achieving higher reprogramming efficiency than fibroblasts. However, most studies utilized a retroviral or lentiviral method for reprogramming of keratinocytes, which introduces undesirable transgene integrations into the host genome. Moreover, current protocols of generating integration-free hiPS cells from keratinocytes are mostly inefficient. In this paper, we describe a more efficient, simple-to-use, and cost-effective method for generating integration-free hiPS cells from keratinocytes. Our improved method using lipid-mediated transfection achieved a reprogramming efficiency of ~0.14% on average. Keratinocyte-derived hiPS cells showed no integration of episomal vectors, expressed stem cell-specific markers and possessed potentials to differentiate into all three germ layers by in vitro embryoid body formation as well as in vivo teratoma formation. To our knowledge, this represents the most efficient method to generate integration-free hiPS cells from keratinocytes. © AlphaMed Press 2014.

Access to Document (DOI)

A genetically engineered ovarian cancer mouse model based on fallopian tube transformation mimics human high-grade serous carcinoma development

Sherman-Baust Cheryl A., Kuhn Elisabetta, Valle Blanca L., Shih Ie Ming, Kurman Robert J., Wang Tian Li, Amano Tomokazu, Ko Minoru Sh, Miyoshi Ichiro, Araki Yoshihiko, Lehrmann Elin, Zhang Yongqing, Becker Kevin G., Morin Patrice J.

Journal of Pathology 233 （ 3 ） 228 - 237 2014年

ISSN 0022-3417

Recent evidence suggests that ovarian high-grade serous carcinoma (HGSC) originates from the epithelium of the fallopian tube. However, most mouse models are based on the previous prevailing view that ovarian cancer develops from the transformation of the ovarian surface epithelium. Here, we report the extensive histological and molecular characterization of the mogp-TAg transgenic mouse, which expresses the SV40 large T-antigen (TAg) under the control of the mouse müllerian-specific Ovgp-1 promoter. Histological analysis of the fallopian tubes of mogp-TAg mice identified a variety of neoplastic lesions analogous to those described as precursors to ovarian HGSC. We identified areas of normal-appearing p53-positive epithelium that are similar to 'p53 signatures' in the human fallopian tube. More advanced proliferative lesions with nuclear atypia and epithelial stratification were also identified that were morphologically and immunohistochemically reminiscent of human serous tubal intraepithelial carcinoma (STIC), a potential precursor of ovarian HGSC. Beside these non-invasive precursor lesions, we also identified invasive adenocarcinoma in the ovaries of 56% of the mice. Microarray analysis revealed several genes differentially expressed between the fallopian tube of mogp-TAg and wild-type (WT) C57BL/6. One of these genes, Top2a, which encodes topoisomerase IIα, was shown by immunohistochemistry to be concurrently expressed with elevated p53 and was specifically elevated in mouse STICs but not in the surrounding tissues. TOP2A protein was also found elevated in human STICs, low-grade and high-grade serous carcinoma. The mouse model reported here displays a progression from normal tubal epithelium to invasive HGSC in the ovary, and therefore closely simulates the current emerging model of human ovarian HGSC pathogenesis. This mouse therefore has the potential to be a very useful new model for elucidating the mechanisms of serous ovarian tumourigenesis, as well as for developing novel approaches for the prevention, diagnosis and therapy of this disease. Published 2014. This article has been contributed to by US Government employees and their work is in the public domain in the USA. © Published 2014. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

Access to Document (DOI)

Identification of transcription factors for lineage-specific ESC differentiation

Yamamizu Kohei, Piao Yulan, Sharov Alexei A., Zsiros Veronika, Yu Hong, Nakazawa Kazu, Schlessinger David, Ko Minoru S H

Stem Cell Reports 1 （ 6 ） 545 - 559 2013年12月

ISSN 2213-6711

A network of transcription factors (TFs) determines cell identity, but identity can be altered by overexpressing a combination of TFs. However, choosing and verifying combinations of TFs for specific cell differentiation have been daunting due to the large number of possible combinations of ∼2,000 TFs. Here, we report the identification of individual TFs for lineage-specific cell differentiation based on the correlation matrix of global gene expression profiles. The overexpression of identified TFs - Myod1, Mef2c, Esx1, Foxa1, Hnf4a, Gata2, Gata3, Myc, Elf5, Irf2, Elf1, Sfpi1, Ets1, Smad7, Nr2f1, Sox11, Dmrt1, Sox9, Foxg1, Sox2, or Ascl1 - can direct efficient, specific, and rapid differentiation into myocytes, hepatocytes, blood cells, and neurons. Furthermore, transfection of synthetic mRNAs of TFs generates their appropriate target cells. These results demonstrate both the utility of this approach to identify potent TFs for cell differentiation, and the unanticipated capacity of single TFs directly guides differentiation to specific lineage fates. © 2013 The Authors.

Access to Document (DOI)

A conserved Oct4/POUV-dependent network links adhesion and migration to progenitor maintenance

Livigni Alessandra, Peradziryi Hanna, Sharov Alexei A., Chia Gloryn, Hammachi Fella, Migueles Rosa Portero, Sukparangsi Woranop, Pernagallo Salvatore, Bradley Mark, Nichols Jennifer, Ko Minoru S H, Brickman Joshua M.

Current Biology 23 （ 22 ） 2233 - 2244 2013年11月

ISSN 0960-9822

Background The class V POU domain transcription factor Oct4 (Pou5f1) is a pivotal regulator of embryonic stem cell (ESC) self-renewal and reprogramming of somatic cells to induced pluripotent stem (iPS) cells. Oct4 is also an important evolutionarily conserved regulator of progenitor cell differentiation during embryonic development. Results Here we examine the function of Oct4 homologs in Xenopus embryos and compare this to the role of Oct4 in maintaining mammalian embryo-derived stem cells. Based on a combination of expression profiling of Oct4/POUV-depleted Xenopus embryos and in silico analysis of existing mammalian Oct4 target data sets, we defined a set of evolutionary-conserved Oct4/POUV targets. Most of these targets were regulators of cell adhesion. This is consistent with Oct4/POUV phenotypes observed in the adherens junctions in Xenopus ectoderm, mouse embryonic, and epiblast stem cells. A number of these targets could rescue both Oct4/POUV phenotypes in cellular adhesion and multipotent progenitor cell maintenance, whereas expression of cadherins on their own could only transiently support adhesion and block differentiation in both ESC and Xenopus embryos. Conclusions Currently, the list of Oct4 transcriptional targets contains thousands of genes. Using evolutionary conservation, we identified a core set of functionally relevant factors that linked the maintenance of adhesion to Oct4/POUV. We found that the regulation of adhesion by the Oct4/POUV network occurred at both transcriptional and posttranslational levels and was required for pluripotency. © 2013 Elsevier Ltd.

Access to Document (DOI)

Role of iPSC-Producing Factors in Pre-Implantation Embryos

Amano Tomokazu, Ko Minoru S H

473 - 484 2013年10月

Although the induced pluripotent stem cell (iPSC) procedure has clearly become the method of choice because of its convenience and for ethical considerations, when generating pluripotent stem cells from somatic cells, it is still important to consider the number of advantageous features of the somatic cell nuclear transfer procedure. For example, it will be interesting to discover whether iPSC factors, which were originally identified as genes expressed specifically in embryonic stem cells, can account for all of the unknown reprogramming factors present in pre-implantation embryos. With this point in mind, in this chapter we will review each reprogramming factor that has been reported in mouse and human iPSC studies from the perspective of its expression pattern in pre-implantation embryos. We will also examine some of the candidate genes that are expressed in pre-implantation embryos but do not form part of the common iPSC factors due to their lack of or low expression in embryonic stem cells, because such factors may help to efficiently produce high-quality iPSCs. © 2014 Elsevier Inc. All rights reserved.

Access to Document (DOI)

Top3β is an RNA topoisomerase that works with fragile X syndrome protein to promote synapse formation

Xu Dongyi, Shen Weiping, Guo Rong, Xue Yutong, Peng Wei, Sima Jian, Yang Jay, Sharov Alexei, Srikantan Subramanya, Yang Jiandong, Fox David, Qian Yong, Martindale Jennifer L., Piao Yulan, Machamer James, Joshi Samit R., Mohanty Subhasis, Shaw Albert C., Lloyd Thomas E., Brown Grant W., Ko Minoru S H, Gorospe Myriam, Zou Sige, Wang Weidong

Nature Neuroscience 16 （ 9 ） 1238 - 1247 2013年09月

ISSN 1097-6256

Topoisomerases are crucial for solving DNA topological problems, but they have not been linked to RNA metabolism. Here we show that human topoisomerase 3β (Top3β) is an RNA topoisomerase that biochemically and genetically interacts with FMRP, a protein that is deficient in fragile X syndrome and is known to regulate the translation of mRNAs that are important for neuronal function, abnormalities of which are linked to autism. Notably, the FMRP-Top3β interaction is abolished by a disease-associated mutation of FMRP, suggesting that Top3β may contribute to the pathogenesis of mental disorders. Top3β binds multiple mRNAs encoded by genes with neuronal functions linked to schizophrenia and autism. Expression of one such gene, that encoding protein tyrosine kinase 2 (ptk2, also known as focal adhesion kinase or FAK), is reduced in the neuromuscular junctions of Top3β mutant flies. Synapse formation is defective in Top3β mutant flies and mice, as well as in FMRP mutant flies and mice. Our findings suggest that Top3β acts as an RNA topoisomerase and works with FMRP to promote the expression of mRNAs that are crucial for neurodevelopment and mental health. © 2013 Nature America, Inc. All rights reserved.

Access to Document (DOI)

Repression of global protein synthesis by Eif1a-like genes that are expressed specifically in the two-cell embryos and the transient Zscan4-positive state of embryonic stem cells

Hung Sandy S C, Wong Raymond C B, Sharov Alexei A., Nakatake Yuhki, Yu Hong, Ko Minoru S H

DNA Research 20 （ 4 ） 391 - 401 2013年08月

ISSN 1340-2838

Mouse embryonic stem (ES) cells are prototypical stem cells that remain undifferentiated in culture for long periods, yet maintain the ability to differentiate into essentially all cell types. Previously, we have reported that ES cells oscillate between two distinct states, which can be distinguished by the transient expression of Zscan4 genes originally identified for its specific expression in mouse two-cell stage embryos. Here, we report that the nascent protein synthesis is globally repressed in the Zscan4-positive state of ES cells, which is mediated by the transient expression of newly identified eukaryotic translation initiation factor 1A (Eif1a)-like genes. Eif1a-like genes, clustered on Chromosome 12, show the high sequence similarity to the Eifa1 and consist of 10 genes (Eif1al1-Eif1al10) and 9 pseudogenes (Eif1al-ps1-Eif1al-ps9). The analysis of the expressed sequence tag database showed that Eif1a-like genes are expressed mostly in the two-cell stage mouse embryos. Microarray analyses and quantitative real-time polymerase chain reaction analyses show that Eif1a-like genes are expressed specifically in the Zscan4-positive state of ES cells. These results indicate a novel mechanism to repress protein synthesis by Eif1a-like genes and a unique mode of protein synthesis regulation in ES cells, which undergo a transient and reversible repression of global protein synthesis in the Zscan4-positive state. © 2013 © The Author 2013. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Access to Document (DOI)

Inflammation increases cells expressing ZSCAN4 and progenitor cell markers in the adult pancreas

Ko Shigeru B H, Azuma Sakiko, Yokoyama Yukihiro, Yamamoto Akiko, Kyokane Kazuhiro, Niida Shumpei, Ishiguro Hiroshi, Ko Minoru S H

American Journal of Physiology - Gastrointestinal and Liver Physiology 304 （ 12 ） 2013年06月

ISSN 0193-1857

We have recently identified the zinc finger and SCAN domain containing 4 (Zscan4), which is transiently expressed and regulates telomere elongation and genome stability in mouse embryonic stem (ES) cells. The aim of this study was to examine the expression of ZSCAN4 in the adult pancreas and elucidate the role of ZSCAN4 in tissue inflammation and subsequent regeneration. The expression of ZSCAN4 and other progenitor or differentiated cell markers in the human pancreas was immunohistochemically examined. Pancreas sections of alcoholic or autoimmune pancreatitis patients before and under maintenance corticosteroid treatment were used in this study. In the adult human pancreas a small number of ZSCAN4-positive (ZSCAN4⁺) cells are present among cells located in the islets of Langerhans, acini, ducts, and oval-shaped cells. These cells not only express differentiated cell markers for each compartment of the pancreas but also express other tissue stem/progenitor cell markers. Furthermore, the number of ZSCAN4⁺ cells dramatically increased in patients with chronic pancreatitis, especially in the pancreatic tissues of autoimmune pancreatitis actively regenerating under corticosteroid treatment. Interestingly, a number of ZSCAN4⁺ cells in the pancreas of autoimmune pancreatitis returned to the basal level after 1 yr of maintenance corticosteroid treatment. In conclusion, coexpression of progenitor cell markers and differentiated cell markers with ZSCAN4 in each compartment of the pancreas may indicate the presence of facultative progenitors for both exocrine and endocrine cells in the adult pancreas. © 2013 the American Physiological Society.

Access to Document (DOI)

Totipotent Embryonic Stem Cells Arise in Ground-State Culture Conditions

Morgani Sophie M., Canham Maurice A., Nichols Jennifer, Sharov Alexei A., Migueles RosaPortero, Ko Minoru S H, Brickman Joshua M.

Cell Reports 3 （ 6 ） 1945 - 1957 2013年03月

Embryonic stem cells (ESCs) are derived from mammalian embryos during the transition from totipotency, when individual blastomeres can make all lineages, to pluripotency, when they are competent to make only embryonic lineages. ESCs maintained with inhibitors of MEK and GSK3 (2i) are thought to represent an embryonically restricted ground state. However, we observed heterogeneous expression of the extraembryonic endoderm marker Hex in 2i-cultured embryos, suggesting that 2i blocked development prior to epiblast commitment. Similarly, 2i ESC cultures were heterogeneous and contained a Hex-positive fraction primed to differentiate into trophoblast and extraembryonic endoderm. Single Hex-positive ESCs coexpressed epiblast and extraembryonic genes and contributed to all lineages in chimeras. The cytokine LIF, necessary for ESC self-renewal, supported the expansion of this population but did not directly support Nanog-positive epiblast-like ESCs. Thus, 2i and LIF support a totipotent state comparable to early embryonic cells that coexpress embryonic and extraembryonic determinants. © 2013 The Authors.

Access to Document (DOI)

Developmental arrest and mouse antral not-surrounded nucleolus oocytes

Monti Manuela, Zanoni Mario, Calligaro Alberto, Ko Minoru S H, Mauri Pierluigi, Redi Carlo Alberto

Biology of Reproduction 88 （ 1 ） 2013年01月

ISSN 0006-3363

The antral compartment in the ovary consists of two populations of oocytes that differ by their ability to resume meiosis and to develop to the blastocyst stage. For reasons still not entirely clear, antral oocytes termed surrounded nucleolus (SN; 70% of the population of antral oocytes) develop to the blastocyst stage, whereas those called not-surrounded nucleolus (NSN) arrest at two cells. We profiled transcriptomic, proteomic, and morphological characteristics of antral oocytes and observed that NSN oocyte arrest is associated with lack of cytoplasmic lattices coincident with reduced expression of MATER and ribosomal proteins. Cytoplasmic lattices have been shown to store maternally derived mRNA and ribosomes in mammalian oocytes and embryos, and MATER has been shown to be required for cytoplasmic lattice formation. Thus, we isolated antral oocytes from a Mater^tm/tm mouse and we observed that 84% of oocytes are of the NSN type. Our results provide the first molecular evidence to account for inability of NSN-derived embryos to progress beyond the two-cell stage; these results may be relevant to naturally occurring preimplantation embryo demise in mammals. © 2013 by the Society for the Study of Reproduction, Inc.

Access to Document (DOI)

Systematic repression of transcription factors reveals limited patterns of gene expression changes in ES cells

Nishiyama Akira, Sharov Alexei A., Piao Yulan, Amano Misa, Amano Tomokazu, Hoang Hien G., Binder Bernard Y., Tapnio Richard, Bassey Uwem, Malinou Justin N., Correa-Cerro Lina S., Yu Hong, Xin Li, Meyers Emily, Zalzman Michal, Nakatake Yuhki, Stagg Carole, Sharova Lioudmila, Qian Yong, Dudekula Dawood, Sheer Sarah, Cadet Jean S., Hirata Tetsuya, Yang Hsih Te, Goldberg Ilya, Evans Michele K., Longo Dan L., Schlessinger David, Ko Minoru S H

Scientific Reports 3 2013年

Networks of transcription factors (TFs) are thought to determine and maintain the identity of cells. Here we systematically repressed each of 100 TFs with shRNA and carried out global gene expression profiling in mouse embryonic stem (ES) cells. Unexpectedly, only the repression of a handful of TFs significantly affected transcriptomes, which changed in two directions/ trajectories: one trajectory by the repression of either Pou5f1 or Sox2; the other trajectory by the repression of either Esrrb, Sall4, Nanog, or Tcfap4. The data suggest that the trajectories of gene expression change are already preconfigured by the gene regulatory network and roughly correspond to extraembryonic and embryonic fates of cell differentiation, respectively. These data also indicate the robustness of the pluripotency gene network, as the transient repression of most TFs did not alter the transcriptomes.

Access to Document (DOI)

Zscan4 restores the developmental potency of embryonic stem cells.

Amano Tomokazu, Hirata Tetsuya, Falco Geppino, Monti Manuela, Sharova Lioudmila V., Amano Misa, Sheer Sarah, Hoang Hien G., Piao Yulan, Stagg Carole A., Yamamizu Kohei, Akiyama Tomohiko, Ko Minoru S H

Nature Communications 4 2013年

The developmental potency of mouse embryonic stem (ES) cells, which is the ability to contribute to a whole embryo, is known to deteriorate during long-term cell culture. Previously, we have shown that ES cells oscillate between Zscan4(-) and Zscan4(+) states, and the transient activation of Zscan4 is required for the maintenance of telomeres and genome stability of ES cells. Here we show that increasing the frequency of Zscan4 activation in mouse ES cells restores and maintains their developmental potency in long-term cell culture. Injection of a single ES cell with such increased potency into a tetraploid blastocyst gives rise to an entire embryo with a higher success rate. These results not only provide a means to rejuvenate ES cells by manipulating Zscan4 expression, but also indicate the active roles of Zscan4 in the long-term maintenance of ES cell potency.

Silencing or amplification of endocannabinoid signaling in blastocysts via CB₁ compromises trophoblast cell migration

Xie Huirong, Sun Xiaofei, Piao Yulan, Jegga Anil G., Handwerger Stuart, Ko Minoru S H, Dey Sudhansu K.

Journal of Biological Chemistry 287 （ 38 ） 32288 - 32297 2012年09月

ISSN 0021-9258

Endocannabinoid signaling plays key roles in multiple female reproductive events. Previous studies have shown an interesting phenomenon, that mice with either silenced or elevated endocannabinoid signaling via Cnr1 encoding CB ₁ show similar defects in several pregnancy events, including preimplantation embryo development. To unravel the downstream signaling of this phenomenon, microarray studies were performed using RNAs collected from WT, Cnr1^-/-, and Faah^-/- mouse blastocysts on day 4 of pregnancy. The results indicate that about 100 genes show unidirectional changes under either silenced or elevated anandamide signaling via CB₁. Functional enrichment analysis of the microarray data predicted that multiple biological functions and pathways are affected under aberrant endocannabinoid signaling. Among them, genes enriched in cell migration are suppressed in Cnr1^-/- or Faah^-/- blastocysts. Cell migration assays validated the prediction of functional enrichment analysis that cell mobility and spreading of either Cnr1^-/- or Faah^-/- trophoblast stem cells are compromised. Either silenced or elevated endocannabinoid signaling via CB₁ causes similar changes in downstream targets in preimplantation embryos and trophoblast stem cells. This study provides evidence that a tightly regulated endocannabinoid signaling is critical to normal preimplantation embryo development and migration of trophoblast stem cells.

Access to Document (DOI)

Prenatal arsenic exposure alters gene expression in the adult liver to a proinflammatory state contributing to accelerated atherosclerosis

States J. Christopher, Singh Amar V., Knudsen Thomas B., Rouchka Eric C., Ngalame Ntube O., Arteel Gavin E., Piao Yulan, Ko Minoru S H

PLoS ONE 7 （ 6 ） 2012年06月

The mechanisms by which environmental toxicants alter developmental processes predisposing individuals to adult onset chronic disease are not well-understood. Transplacental arsenic exposure promotes atherogenesis in apolipoprotein E-knockout (ApoE^-/-) mice. Because the liver plays a central role in atherosclerosis, diabetes and metabolic syndrome, we hypothesized that accelerated atherosclerosis may be linked to altered hepatic development. This hypothesis was tested in ApoE^-/- mice exposed to 49 ppm arsenic in utero from gestational day (GD) 8 to term. GD18 hepatic arsenic was 1.2 μg/g in dams and 350 ng/g in fetuses. The hepatic transcriptome was evaluated by microarray analysis to assess mRNA and microRNA abundance in control and exposed pups at postnatal day (PND) 1 and PND70. Arsenic exposure altered postnatal developmental trajectory of mRNA and microRNA profiles. We identified an arsenic exposure related 51-gene signature at PND1 and PND70 with several hubs of interaction (Hspa8, IgM and Hnf4a). Gene ontology (GO) annotation analyses indicated that pathways for gluconeogenesis and glycolysis were suppressed in exposed pups at PND1, and pathways for protein export, ribosome, antigen processing and presentation, and complement and coagulation cascades were induced by PND70. Promoter analysis of differentially-expressed transcripts identified enriched transcription factor binding sites and clustering to common regulatory sites. SREBP1 binding sites were identified in about 16% of PND70 differentially-expressed genes. Western blot analysis confirmed changes in the liver at PND70 that included increases of heat shock protein 70 (Hspa8) and active SREBP1. Plasma AST and ALT levels were increased at PND70. These results suggest that transplacental arsenic exposure alters developmental programming in fetal liver, leading to an enduring stress and proinflammatory response postnatally that may contribute to early onset of atherosclerosis. Genes containing SREBP1 binding sites also suggest pathways for diabetes mellitus and rheumatoid arthritis, both diseases that contribute to increased cardiovascular disease in humans.

Access to Document (DOI)

Activation of JNK triggers release of Brd4 from mitotic chromosomes and mediates protection from drug-induced mitotic stress

Nishiyama Akira, Dey Anup, Tamura Tomohiko, Ko Minoru, Ozato Keiko

PLoS ONE 7 （ 5 ） 2012年05月

Some anti-cancer drugs, including those that alter microtubule dynamics target mitotic cells and induce apoptosis in some cell types. However, such drugs elicit protective responses in other cell types allowing cells to escape from drug-induced mitotic inhibition. Cells with a faulty protective mechanism undergo defective mitosis, leading to genome instability. Brd4 is a double bromodomain protein that remains on chromosomes during mitosis. However, Brd4 is released from mitotic chromosomes when cells are exposed to anti-mitotic drugs including nocodazole. Neither the mechanisms, nor the biological significance of drug-induced Brd4 release has been fully understood. We found that deletion of the internal C-terminal region abolished nocodazole induced Brd4 release from mouse P19 cells. Furthermore, cells expressing truncated Brd4, unable to dissociate from chromosomes were blocked from mitotic progression and failed to complete cell division. We also found that pharmacological and peptide inhibitors of the c-jun-N-terminal kinases (JNK) pathway, but not inhibitors of other MAP kinases, prevented release of Brd4 from chromosomes. The JNK inhibitor that blocked Brd4 release also blocked mitotic progression. Further supporting the role of JNK in Brd4 release, JNK2-/- embryonic fibroblasts were defective in Brd4 release and sustained greater inhibition of cell growth after nocodazole treatment. In sum, activation of JNK pathway triggers release of Brd4 from chromosomes upon nocodazole treatment, which mediates a protective response designed to minimize drug-induced mitotic stress.

Access to Document (DOI)

Stochastic modeling for the expression of a gene regulated by competing transcription factors

Yang Hsih Te, Ko Minoru S H

PLoS ONE 7 （ 3 ） 2012年03月

It is widely accepted that gene expression regulation is a stochastic event. The common approach for its computer simulation requires detailed information on the interactions of individual molecules, which is often not available for the analyses of biological experiments. As an alternative approach, we employed a more intuitive model to simulate the experimental result, the Markov-chain model, in which a gene is regulated by activators and repressors, which bind the same site in a mutually exclusive manner. Our stochastic simulation in the presence of both activators and repressors predicted a Hill-coefficient of the dose-response curve closer to the experimentally observed value than the calculated value based on the simple additive effects of activators alone and repressors alone. The simulation also reproduced the heterogeneity of gene expression levels among individual cells observed by Fluorescence Activated Cell Sorting analysis. Therefore, our approach may help to apply stochastic simulations to broader experimental data.

Access to Document (DOI)

Transcriptional Activation by Oct4 Is Sufficient for the Maintenance and Induction of Pluripotency

Hammachi Fella, Morrison Gillian M., Sharov Alexei A., Livigni Alessandra, Narayan Santosh, Papapetrou Eirini P., O'Malley James, Kaji Keisuke, Ko Minoru S H, Ptashne Mark, Brickman Joshua M.

Cell Reports 1 （ 2 ） 99 - 109 2012年02月

Oct4 is an essential regulator of pluripotency in vivo and in vitro in embryonic stem cells, as well as a key mediator of the reprogramming of somatic cells into induced pluripotent stem cells. It is not known whether activation and/or repression of specific genes by Oct4 is relevant to these functions. Here, we show that fusion proteins containing the coding sequence of Oct4 or Xlpou91 (the . Xenopus homolog of Oct4) fused to activating regions, but not those fused to repressing regions, behave as Oct4, suppressing differentiation and promoting maintenance of undifferentiated phenotypes in vivo and in vitro. An Oct4 activation domain fusion supported embryonic stem cell self-renewal in vitro at lower concentrations than that required for Oct4 while alleviating the ordinary requirement for the cytokine LIF. At still lower levels of the fusion, LIF dependence was restored. We conclude that the necessary and sufficient function of Oct4 in promoting pluripotency is to activate specific target genes.

Access to Document (DOI)

Forkhead transcription factor FoxA1 regulates sweat secretion through Bestrophin 2 anion channel and Na-K-Cl cotransporter 1

Cui Chang Yi, Childress Victoria, Piao Yulan, Michel Marc, Johnson Adiv A., Kunisada Makoto, Ko Minoru S H, Kaestner Klaus H., Marmorstein Alan D., Schlessinger David

Proceedings of the National Academy of Sciences of the United States of America 109 （ 4 ） 1199 - 1203 2012年01月

ISSN 0027-8424

Body temperature is maintained in a narrow range in mammals, primarily controlled by sweating. In humans, the dynamic thermoregulatory organ, comprised of 2-4 million sweat glands distributed over the body, can secrete up to 4 L of sweat per day, thereby making it possible to withstand high temperatures and endure prolonged physical stress (e.g., long-distance running). The genetic basis for sweat gland function, however, is largely unknown. We find that the forkhead transcription factor, FoxA1, is required to generate mouse sweating capacity. Despite continued sweat gland morphogenesis, ablation of FoxA1 in mice results in absolute anihidrosis (lack of sweating). This inability to sweat is accompanied by down-regulation of the Na-K-Cl cotransporter 1 (Nkcc1) and the Ca ²⁺-activated anion channel Bestrophin 2 (Best2), as well as glycoprotein accumulation in gland lumens and ducts. Furthermore, Best2-deficient mice display comparable anhidrosis and glycoprotein accumulation. These findings link earlier observations that both sodium/potassium/chloride exchange and Ca ²⁺ are required for sweat production. FoxA1 is inferred to regulate two corresponding features of sweat secretion. One feature, via Best2, catalyzes a bicarbonate gradient that could help to drive calcium-associated ionic transport; the other, requiring Nkcc1, facilitates monovalent ion exchange into sweat. These mechanistic components can be pharmaceutical targets to defend against hyperthermia and alleviate defective thermoregulation in the elderly, and may provide a model relevant to more complex secretory processes.

Access to Document (DOI)

Molecular mechanisms of pancreatic stone formation in chronic pancreatitis

Ko Shigeru B H, Azuma Sakiko, Yoshikawa Toshiyuki, Yamamoto Akiko, Kyokane Kazuhiro, Ko Minoru S H, Ishiguro Hiroshi

Frontiers in Physiology 3 NOV 2012年

Chronic pancreatitis (CP) is a progressive inflammatory disease in which the pancreatic secretory parenchyma is destroyed and replaced by fibrosis. The presence of intraductal pancreatic stone(s) is important for the diagnosis of CP; however, the precise molecular mechanisms of pancreatic stone formation in CP were left largely unknown. Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel expressed in the apical plasma membrane of pancreatic duct cells and plays a central role in HCO₃^- secretion. In previous studies, we have found that CFTR is largely mislocalized to the cytoplasm of pancreatic duct cells in all forms of CP and corticosteroids normalizes the localization of CFTR to the proper apical membrane at least in autoimmune pancreatitis. From these observations, we could conclude that the mislocalization of CFTR is a cause of protein plug formation in CP, subsequently resulting in pancreatic stone formation. Considering our observation that the mislocalization of CFTR also occurs in alcoholic or idiopathic CP, it is very likely that these pathological conditions can also be treated by corticosteroids, thereby preventing pancreatic stone formation in these patients. Further studies are definitely required to clarify these fundamental issues. © 2012 Ko, Azuma, Yoshikawa, Yamamoto, Kyokane, Ko and Ishiguro.

Access to Document (DOI)

Zscan4 transiently reactivates early embryonic genes during the generation of induced pluripotent stem cells

Hirata Tetsuya, Amano Tomokazu, Nakatake Yuhki, Amano Misa, Piao Yulan, Hoang Hien G., Ko Minoru S H

Scientific Reports 2 2012年

The generation of induced pluripotent stem cells (iPSCs) by the forced expression of defined transcription factors in somatic cells holds great promise for the future of regenerative medicine. However, the initial reprogramming mechanism is still poorly understood. Here we show that Zscan4, expressed transiently in 2-cell embryos and embryonic stem cells (ESCs), efficiently produces iPSCs from mouse embryo fibroblasts when coexpressed with Klf4, Oct4, and Sox2. Interestingly, the forced expression of Zscan4 is required only for the first few days of iPSC formation. Microarray analysis revealed transient and early induction of preimplantation-specific genes in a Zscan4-dependent manner. Our work indicates that Zscan4 is a previously unidentified potent natural factor that facilitates the reprogramming process and reactivates early embryonic genes.

Access to Document (DOI)

Mouse B-type lamins are required for proper organogenesis but not by embryonic stem cells

Kim Youngjo, Sharov Alexei A., McDole Katie, Cheng Melody, Hao Haiping, Fan Chen Ming, Gaiano Nicholas, Ko Minoru S H, Zheng Yixian

Science 334 （ 6063 ） 1706 - 1710 2011年12月

ISSN 0036-8075

B-type lamins, the major components of the nuclear lamina, are believed to be essential for cell proliferation and survival. We found that mouse embryonic stem cells (ESCs) do not need any lamins for self-renewal and pluripotency. Although genome-wide lamin-B binding profiles correlate with reduced gene expression, such binding is not directly required for gene silencing in ESCs or trophectoderm cells. However, B-type lamins are required for proper organogenesis. Defects in spindle orientation in neural progenitor cells and migration of neurons probably cause brain disorganizations found in lamin-B null mice. Thus, our studies not only disprove several prevailing views of lamin-Bs but also establish a foundation for redefining the function of the nuclear lamina in the context of tissue building and homeostasis.

Access to Document (DOI)

Responsiveness of genes to manipulation of transcription factors in ES cells is associated with histone modifications and tissue specificity

Sharov Alexei A., Nishiyama Akira, Piao Yulan, Correa-Cerro Lina S., Amano Tomokazu, Thomas Marshall, Mehta Samir, Ko Minoru S H

BMC Genomics 12 2011年02月

ISSN 1471-2164

Background: In addition to determining static states of gene expression (high vs. low), it is important to characterize their dynamic status. For example, genes with H3K27me3 chromatin marks are not only suppressed but also poised for activation. However, the responsiveness of genes to perturbations has never been studied systematically. To distinguish gene responses to specific factors from responsiveness in general, it is necessary to analyze gene expression profiles of cells responding to a large variety of disturbances, and such databases did not exist before.Results: We estimated the responsiveness of all genes in mouse ES cells using our recently published database on expression change after controlled induction of 53 transcription factors (TFs) and other genes. Responsive genes (N = 4746), which were readily upregulated or downregulated depending on the kind of perturbation, mostly have regulatory functions and a propensity to become tissue-specific upon differentiation. Tissue-specific expression was evaluated on the basis of published (GNF) and our new data for 15 organs and tissues. Non-responsive genes (N = 9562), which did not change their expression much following any perturbation, were enriched in housekeeping functions. We found that TF-responsiveness in ES cells is the best predictor known for tissue-specificity in gene expression. Among genes with CpG islands, high responsiveness is associated with H3K27me3 chromatin marks, and low responsiveness is associated with H3K36me3 chromatin, stronger tri-methylation of H3K4, binding of E2F1, and GABP binding motifs in promoters.Conclusions: We thus propose the responsiveness of expression to perturbations as a new way to define the dynamic status of genes, which brings new insights into mechanisms of regulation of gene expression and tissue specificity. © 2011 Sharov et al; licensee BioMed Central Ltd.

Access to Document (DOI)

Generation of mouse ES cell lines engineered for the forced induction of transcription factors

Correa-Cerro Lina S., Piao Yulan, Sharov Alexei A., Nishiyama Akira, Cadet Jean S., Yu Hong, Sharova Lioudmila V., Xin Li, Hoang Hien G., Thomas Marshall, Qian Yong, Dudekula Dawood B., Meyers Emily, Binder Bernard Y., Mowrer Gregory, Bassey Uwem, Longo Dan L., Schlessinger David, Ko Minoru S H

Scientific Reports 1 2011年

Here we report the generation and characterization of 84 mouse ES cell lines with doxycycline-controllable transcription factors (TFs) which, together with the previous 53 lines, cover 7-10% of all TFs encoded in the mouse genome. Global gene expression profiles of all 137 lines after the induction of TFs for 48 hrs can associate each TF with the direction of ES cell differentiation, regulatory pathways, and mouse phenotypes. These cell lines and microarray data provide building blocks for a variety of future biomedical research applications as a community resource.

Access to Document (DOI)

A role for borg5 during trophectoderm differentiation.

Vong Queenie P., Liu Zhonghua, Yoo Jae Gyu, Chen Rong, Xie Wen, Sharov Alexei A., Fan Chen Ming, Liu Chengyu, Ko Minoru S H, Zheng Yixian

Stem cells (Dayton, Ohio) 28 （ 6 ） 1030 - 1038 2010年06月

Stem cell differentiation is accompanied by a gradual cellular morphogenesis and transcriptional changes. Identification of morphological regulators that control cell behavior during differentiation could shed light on how cell morphogenesis is coupled to transcriptional changes during development. By analyzing cellular behavior during differentiation of mouse embryonic stem cells (ESCs), we uncover a role of Borg5 (binder of Rho guanosine 5'-triphosphatase 5) in regulating trophectoderm (TE) cell morphogenesis. We report that differentiation of ESCs toward TE is accompanied by enhanced actin protrusion and cell motility that require upregulation of Borg5. Borg5 interacts with both Cdc42 and atypical protein kinase C (aPKC) and functions downstream of Cdc42 to enhance TE cell motility. Borg5 is required for the sorting of differentiating TE to the outside of ESCs in vitro. In developing embryos, Borg5 protein localizes to cell-cell contacts and the cytoplasm after compaction. It exhibits higher levels of expression in outer cells than in inner cells in morula and blastocysts. Reduction of Borg5 disrupts aPKC localization and inhibits blastocyst formation. Since Cdx2 and Borg5 facilitate each other's expression as ESCs differentiate toward TE, we propose that cell morphogenesis is coupled with transcriptional changes to regulate TE differentiation. Our studies also demonstrate the utility of ESCs in identifying morphological regulators important for development.

Access to Document (DOI)

Functional heterogeneity of embryonic stem cells revealed through translational amplification of an early endodermal transcript

Canham Maurice A., Sharov Alexei A., Ko Minoru S H, Brickman Joshua M.

PLoS Biology 8 （ 5 ） 2010年05月

ISSN 1544-9173

ES cells are defined as self-renewing, pluripotent cell lines derived from early embryos. Cultures of ES cells are also characterized by the expression of certain markers thought to represent the pluripotent state. However, despite the widespread expression of key markers such as Oct4 and the appearance of a characteristic undifferentiated morphology, functional ES cells may represent only a small fraction of the cultures grown under self-renewing conditions. Thus phenotypically ''undifferentiated'' cells may consist of a heterogeneous population of functionally distinct cell types. Here we use a transgenic allele designed to detect low level transcription in the primitive endoderm lineage as a tool to identify an immediate early endoderm-like ES cell state. This reporter employs a tandem array of internal ribosomal entry sites to drive translation of an enhanced Yellow Fluorescent Protein (Venus) from the transcript that normally encodes for the early endodermal marker Hex. Expression of this Venus transgene reports on single cells with low Hex transcript levels and reveals the existence of distinct populations of Oct4 positive undifferentiated ES cells. One of these cells types, characterized by both the expression of the Venus transgene and the ES cells marker SSEA-1 (V⁺S⁺), appears to represent an early step in primitive endoderm specification. We show that the fraction of cells present within this state is influenced by factors that both promote and suppress primitive endoderm differentiation, but conditions that support ES cell self-renewal prevent their progression into differentiation and support an equilibrium between this state and at least one other that resembles the Nanog positive inner cell mass of the mammalian blastocysts. Interestingly, while these subpopulations are equivalently and clonally interconvertible under self-renewing conditions, when induced to differentiate both in vivo and in vitro they exhibit different behaviours. Most strikingly when introduced back into morulae or blastocysts, the V⁺S⁺ population is not effective at contributing to the epiblast and can contribute to the extra-embryonic visceral and parietal endoderm, while the V²S⁺ population generates high contribution chimeras. Taken together our data support a model in which ES cell culture has trapped a set of interconvertible cell states reminiscent of the early stages in blastocyst differentiation that may exist only transiently in the early embryo.

Access to Document (DOI)

Zscan4 regulates telomere elongation and genomic stability in ES cells

Zalzman Michal, Falco Geppino, Sharova Lioudmila V., Nishiyama Akira, Thomas Marshall, Lee Sung Lim, Stagg Carole A., Hoang Hien G., Yang Hsih Te, Indig Fred E., Wersto Robert P., Ko Minoru S H

Nature 464 （ 7290 ） 858 - 863 2010年04月

ISSN 0028-0836

Exceptional genomic stability is one of the hallmarks of mouse embryonic stem (ES) cells. However, the genes contributing to this stability remain obscure. We previously identified Zscan4 as a specific marker for two-cell embryo and ES cells. Here we show that Zscan4 is involved in telomere maintenance and long-term genomic stability in ES cells. Only 5% of ES cells express Zscan4 at a given time, but nearly all ES cells activate Zscan4 at least once during nine passages. The transient Zscan4-positive state is associated with rapid telomere extension by telomere recombination and upregulation of meiosis-specific homologous recombination genes, which encode proteins that are colocalized with ZSCAN4 on telomeres. Furthermore, Zscan4 knockdown shortens telomeres, increases karyotype abnormalities and spontaneous sister chromatid exchange, and slows down cell proliferation until reaching crisis by passage eight. Together, our data show a unique mode of genome maintenance in ES cells. © 2010 Macmillan Publishers Limited. All rights reserved.

Access to Document (DOI)

Changes in global gene expression during in vitro decidualization of rat endometrial stromal cells

Vallejo Griselda, Maschi Darío, Mestre-Citrinovitz Ana C., Aiba Kazuhiro, Maronna Ricardo, Yohai Victor, Ko Minoru S H, Beato Miguel, Saragüeta Patricia

Journal of Cellular Physiology 222 （ 1 ） 127 - 137 2010年01月

ISSN 0021-9541

During the preimplantation phase of pregnancy the endometrial stroma differentiates into decidua, a process that implies numerous morphological changes and is an example of physiological transdifferentiation. Here we show that UIII rat endometrial stromal cells cultured in the presence of calf serum acquired morphological features of decidual cells and expressed decidual markers. To identify genes involved in decidualization we compared gene expression patterns of control and decidualized UIII cells using cDNA microarray. We found 322 annotated genes exhibiting significant differences in expression (>3-fold, fold discovery rate (FDR) >0.005), of which 312 have not been previously related to decidualization. Analysis of overrepresented functions revealed that protein synthesis, gene expression, and chromatin architecture and remodeling are the most relevant modified functions during decidualization. Relevant genes are also found in the functional terms differentiation, cell proliferation, signal transduction, and matrix/structural proteins. Several of these new genes involved in decidualization (Csdc2, Trim27, Eef1a1, Bmp1, Wt1, Aes, Gna12, and Men1) are shown to be also regulated in uterine decidua during normal pregnancy. Thus, the UIII cell culture model will allow future mechanistic studies to define the transcriptional network regulating reprogramming of stromal cells into decidual cells. © 2009 Wiley-Liss, Inc.

Access to Document (DOI)

Dkk4 and eda regulate distinctive developmental mechanisms for subtypes of mouse hair

Cui Chang Yi, Kunisada Makoto, Piao Yulan, Childress Victoria, Ko Minoru S H, Schlessinger David

PLoS ONE 5 （ 4 ） 2010年

The mouse hair coat comprises protective "primary" and thermo-regulatory "secondary" hairs. Primary hair formation is ectodysplasin (Eda) dependent, but it has been puzzling that Tabby (Eda^-/y) mice still make secondary hair. We report that Dickkopf 4 (Dkk4), a Wnt antagonist, affects an auxiliary pathway for Eda-independent development of secondary hair. A Dkk4 transgene in wild-type mice had no effect on primary hair, but secondary hairs were severely malformed. Dkk4 action on secondary hair was further demonstrated when the transgene was introduced into Tabby mice: the usual secondary follicle induction was completely blocked. The Dkk4-regulated secondary hair pathway, like the Eda-dependent primary hair pathway, is further mediated by selective activation of Shh. The results thus reveal two complex molecular pathways that distinctly regulate subtype-based morphogenesis of hair follicles, and provide a resolution for the longstanding puzzle of hair formation in Tabby mice lacking Eda. © 2010 Greenbaum et al.

Access to Document (DOI)

Gene expression profiling of mouse embryos with microarrays

Sharov Alexei A., Piao Yulan, Ko Minoru S H

Methods in Enzymology 477 （ C ） 511 - 541 2010年

ISSN 0076-6879

Global expression profiling by DNA microarrays provides a snapshot of cell and tissue status and becomes an essential tool in biological and medical sciences. Typical questions that can be addressed by microarray analysis in developmental biology include: (1) to find a set of genes expressed in a specific cell type; (2) to identify genes expressed commonly in multiple cell types; (3) to follow the time-course changes of gene expression patterns; (4) to demonstrate cell's identity by showing similarities or differences among two or multiple cell types; (5) to find regulatory pathways and/or networks affected by gene manipulations, such as overexpression or repression of gene expression; (6) to find downstream target genes of transcription factors; (7) to find downstream target genes of cell signaling; (8) to examine the effects of environmental manipulation of cells on gene expression patterns; and (9) to find the effects of genetic manipulation in embryos and adults. Here, we describe strategies for executing these experiments and monitoring changes of cell state with gene expression microarrays in application to mouse embryology. Both statistical assessment and interpretation of data are discussed. We also present a protocol for performing microarray analysis on a small amount of embryonic materials. © 2010 Elsevier Inc.

Access to Document (DOI)

Trim43a, Trim43b, and Trim43c

Stanghellini Ilaria, Falco Geppino, Lee Sung Lim, Monti Manuela, Ko Minoru S H

Gene Expression Patterns 9 （ 8 ） 595 - 602 2009年12月

ISSN 1567-133X

We describe the identification and characterization of Trim43a, Trim43b, and Trim43c genes, whose expression are restricted to preimplantation stages and peak at the 8-cell to morula stage. We identified a 5 kb DNA fragment that covers upstream region of Trim43a as a putative promoter, which can drive the expression of mStrawberry fluorescent protein in a manner similar to endogenous Trim43 genes. Trim43 genes will be useful stage-specific markers for the study of preimplantation embryos.

Access to Document (DOI)

Uncovering Early Response of Gene Regulatory Networks in ESCs by Systematic Induction of Transcription Factors

Nishiyama Akira, Xin Li, Sharov Alexei A., Thomas Marshall, Mowrer Gregory, Meyers Emily, Piao Yulan, Mehta Samir, Yee Sarah, Nakatake Yuhki, Stagg Carole, Sharova Lioudmila, Correa-Cerro Lina S., Bassey Uwem, Hoang Hien, Kim Eugene, Tapnio Richard, Qian Yong, Dudekula Dawood, Zalzman Michal, Li Manxiang, Falco Geppino, Yang Hsih Te, Lee Sung Lim, Monti Manuela, Stanghellini Ilaria, Islam Md Nurul, Nagaraja Ramaiah, Goldberg Ilya, Wang Weidong, Longo Dan L., Schlessinger David, Ko Minoru S H

Cell Stem Cell 5 （ 4 ） 420 - 433 2009年10月

ISSN 1934-5909

To examine transcription factor (TF) network(s), we created mouse ESC lines, in each of which 1 of 50 TFs tagged with a FLAG moiety is inserted into a ubiquitously controllable tetracycline-repressible locus. Of the 50 TFs, Cdx2 provoked the most extensive transcriptome perturbation in ESCs, followed by Esx1, Sox9, Tcf3, Klf4, and Gata3. ChIP-Seq revealed that CDX2 binds to promoters of upregulated target genes. By contrast, genes downregulated by CDX2 did not show CDX2 binding but were enriched with binding sites for POU5F1, SOX2, and NANOG. Genes with binding sites for these core TFs were also downregulated by the induction of at least 15 other TFs, suggesting a common initial step for ESC differentiation mediated by interference with the binding of core TFs to their target genes. These ESC lines provide a fundamental resource to study biological networks in ESCs and mice. © 2009 Elsevier Inc. All rights reserved.

Access to Document (DOI)

Exhaustive search for over-represented DNA sequence motifs with cisfinder

Sharov Alexei A., Ko Minoru S H

DNA Research 16 （ 5 ） 261 - 273 2009年10月

ISSN 1340-2838

We present CisFinder software, which generates a comprehensive list of motifs enriched in a set of DNA sequences and describes them with position frequency matrices (PFMs). A new algorithm was designed to estimate PFMs directly from counts of n-mer words with and without gaps; then PFMs are extended over gaps and flanking regions and clustered to generate non-redundant sets of motifs. The algorithm successfully identified binding motifs for 12 transcription factors (TFs) in embryonic stem cells based on published chromatin immunoprecipitation sequencing data. Furthermore, CisFinder successfully identified alternative binding motifs of TFs (e.g. POU5F1, ESRRB, and CTCF) and motifs for known and unknown co-factors of genes associated with the pluripotent state of ES cells. CisFinder also showed robust performance in the identification of motifs that were only slightly enriched in a set of DNA sequences.

Access to Document (DOI)

Dax1 binds to Oct3/4 and inhibits its transcriptional activity in embryonic stem cells

Sun Chuanhai, Nakatake Yuhki, Akagi Tadayuki, Ura Hiroki, Matsuda Takahiko, Nishiyama Akira, Koide Hiroshi, Ko Minoru S H, Niwa Hitoshi, Yokota Takashi

Molecular and Cellular Biology 29 （ 16 ） 4574 - 4583 2009年08月

ISSN 0270-7306

Embryonic stem (ES) cells are pluripotent cells derived from the inner cell mass of blastocysts. Transcription factor Oct3/4 is an indispensable factor in the self-renewal of ES cells. In this study, we searched for a protein that would interact with Oct3/4 in ES cells and identified an orphan nuclear hormone receptor, Dax1. The association of Dax1 with Oct3/4 was mediated through the POU-specific domain of Oct3/4. Ectopic expression of Dax1 inhibited Oct3/4-mediated activation of an artificial Oct3/4-responsive promoter. Expression of Dax1 in ES cells also reduced the activities of Nanog and Rex1 promoters, while knockdown of Dax1 increased these activities. Pulldown and gel shift assays revealed that the interaction of Dax1 with Oct3/4 abolished the DNA binding activity of Oct3/4. Chromatin immunoprecipitation assay results showed that Dax1 inhibited Oct3/4 binding to the promoter/enhancer regions of Oct3/4 and Nanog. Furthermore, overexpression of Dax1 resulted in ES cell differentiation. Taken together, these data suggest that Dax1, a novel molecule interacting with Oct3/4, functions as a negative regulator of Oct3/4 in ES cells. Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Access to Document (DOI)

Defining developmental potency and cell lineage trajectories by expression profiling of differentiating mouse embryonic stem cells

Aiba Kazuhiro, Nedorezov Timur, Piao Yulan, Nishiyama Akira, Matoba Ryo, Sharova Lioudmila V., Sharov Alexei A., Yamanaka Shinya, Niwa Hitoshi, Ko Minoru S H

DNA Research 16 （ 1 ） 73 - 80 2009年02月

ISSN 1340-2838

Biologists rely on morphology, function and specific markers to define the differentiation status of cells. Transcript profiling has expanded the repertoire of these markers by providing the snapshot of cellular status that reflects the activity of all genes. However, such data have been used only to assess relative similarities and differences of these cells. Here we show that principal component analysis of global gene expression profiles map cells in multidimensional transcript profile space and the positions of differentiating cells progress in a stepwise manner along trajectories starting from undifferentiated embryonic stem (ES) cells located in the apex. We present three 'cell lineage trajectories', which represent the differentiation of ES cells into the first three lineages in mammalian development: primitive endoderm, trophoblast and primitive ectoderm/neural ectoderm. The positions of the cells along these trajectories seem to reflect the developmental potency of cells and can be used as a scale for the potential of cells. Indeed, we show that embryonic germ cells and induced pluripotent cells are mapped near the origin of the trajectories, whereas mouse embryo fibroblast and fibroblast cell lines are mapped near the far end of the trajectories. We suggest that this method can be used as the non-operational semi-quantitative definition of cell differentiation status and developmental potency. Furthermore, the global expression profiles of cell lineages provide a framework for the future study of in vitro and in vivo cell differentiation.

Access to Document (DOI)

Database for mRNA half-life of 19 977 genes obtained by DNA microarray analysis of pluripotent and differentiating mouse embryonic stem cells

Sharova Lioudmila V., Sharov Alexei A., Nedorezov Timur, Piao Yulan, Shaik Nabeebi, Ko Minoru S H

DNA Research 16 （ 1 ） 45 - 58 2009年02月

ISSN 1340-2838

Degradation of mRNA is one of the key processes that control the steady-state level of gene expression. However, the rate of mRNA decay for the majority of genes is not known. We successfully obtained the rate of mRNA decay for 19 977 non-redundant genes by microarray analysis of RNA samples obtained from mouse embryonic stem (ES) cells. Median estimated half-life was 7.1 h and only <100 genes, including Prdm1, Myc, Gadd45 g, Foxa2, Hes5 and Trib1, showed half-life less than 1 h. In general, mRNA species with short half-life were enriched among genes with regulatory functions (transcription factors), whereas mRNA species with long half-life were enriched among genes related to metabolism and structure (extracellular matrix, cytoskeleton). The stability of mRNAs correlated more significantly with the structural features of genes than the function of genes: mRNA stability showed the most significant positive correlation with the number of exon junctions per open reading frame length, and negative correlation with the presence of PUF-binding motifs and AU-rich elements in 3′-untranslated region (UTR) and CpG di-nucleotides in the 5′-UTR. The mRNA decay rates presented in this report are the largest data set for mammals and the first for ES cells.

Access to Document (DOI)

Maintenance of undifferentiated mouse embryonic stem cells in suspension by the serum- and feeder-free defined culture condition (Developmental Dynamics 237, (2129-2138))

Tsuji Yukiko, Yoshimura Naoko, Aoki Hitomi, Sharov Alexei A., Ko Minoru S H, Motohashi Tsutomu, Kunisada Takahiro

Developmental Dynamics 238 （ 2 ） 501 2009年02月

ISSN 1058-8388

Access to Document (DOI)

Requirement for Shh and Fox family genes at different stages in sweat gland development

Kunisada Makoto, Cui Chang Yi, Piao Yulan, Ko Minoru S H, Schlessinger David

Human Molecular Genetics 18 （ 10 ） 1769 - 1778 2009年

ISSN 0964-6906

Sweat glands play a fundamental role in thermal regulation in man, but the molecular mechanism of their development remains unknown. To initiate analyses, we compared the model of Eda mutant Tabby mice, in which sweat glands were not formed, with wild-type (WT) mice. We inferred developmental stages and critical genes based on observations at seven time points spanning embryonic, postnatal and adult life. In WT footpads, sweat gland germs were detected at E17.5. The coiling of secretory portions started at postnatal day 1 (P1), and sweat gland formation was essentially completed by P5. Consistent with a controlled morphological progression, expression profiling revealed stage-specific gene expression changes. Similar to the development of hair follicles - the other major skin appendage controlled by EDA - sweat gland induction and initial progression were accompanied by Eda-dependent up-regulation of the Shh pathway. During the further development of sweat gland secretory portions, Foxa1 and Foxi1, not at all expressed in hair follicles, were progressively up-regulated in WT but not in Tabby footpads. Upon completion of WT development, Shh declined to Tabby levels, but Fox family genes remained at elevated levels in mature sweat glands. The results provide a framework for the further analysis of phased down-stream regulation of gene action, possibly by a signaling cascade, in response to Eda.

Access to Document (DOI)

Prediction of evolutionarily conserved interologs in Mus musculus

Yellaboina Sailu, Dudekula Dawood B., Ko Minoru S H

BMC Genomics 9 2008年10月

Background: Identification of protein-protein interactions is an important first step to understand living systems. High-throughput experimental approaches have accumulated large amount of information on protein-protein interactions in human and other model organisms. Such interaction information has been successfully transferred to other species, in which the experimental data are limited. However, the annotation transfer method could yield false positive interologs due to the lack of conservation of interactions when applied to phylogenetically distant organisms. Results: To address this issue, we used phylogenetic profile method to filter false positives in interologs based on the notion that evolutionary conserved interactions show similar patterns of occurrence along the genomes. The approach was applied to Mus musculus, in which the experimentally identified interactions are limited. We first inferred the protein-protein interactions in Mus musculus by using two approaches: i) identifying mouse orthologs of interacting proteins (interologs) based on the experimental protein-protein interaction data from other organisms; and ii) analyzing frequency of mouse ortholog co-occurrence in predicted operons of bacteria. We then filtered possible false-positives in the predicted interactions using the phylogenetic profiles. We found that this filtering method significantly increased the frequency of interacting protein-pairs coexpressed in the same cells/tissues in gene expression omnibus (GEO) database as well as the frequency of interacting protein-pairs shared the similar Gene Ontology (GO) terms for biological processes and cellular localizations. The data supports the notion that phylogenetic profile helps to reduce the number of false positives in interologs. Conclusion: We have developed protein-protein interaction database in mouse, which contains 41109 interologs. We have also developed a web interface to facilitate the use of database http://lgsun.grc.nia.nih.gov/ mppi/. © 2008 Yellaboina et al; licensee BioMed Central Ltd.

Access to Document (DOI)

Essential role of chromatin remodeling protein bptf in early mouse embryos and embryonic stem cells

Landry Joseph, Sharov Alexei A., Piao Yulan, Sharova Lioudmila V., Xiao Hua, Southon Eileen, Matta Jennifer, Tessarollo Lino, Zhang Ying E., Ko Minoru S H, Kuehn Michael R., Yamaguchi Terry P., Wu Carl

PLoS Genetics 4 （ 10 ） 2008年10月

ISSN 1553-7390

We have characterized the biological functions of the chromatin remodeling protein Bptf (Bromodomain PHD-finger Transcription Factor), the largest subunit of NURF (Nucleosome Remodeling Factor) in a mammal. Bptf mutants manifest growth defects at the post-implantation stage and are reabsorbed by E8.5. Histological analyses of lineage markers show that Bptf^-/- embryos implant but fail to establish a functional distal visceral endoderm. Microarray analysis at early stages of differentiation has identified Bptf-dependent gene targets including homeobox transcriptions factors and genes essential for the development of ectoderm, mesoderm, and both definitive and visceral endoderm. Differentiation of Bptf^-/- embryonic stem cell lines into embryoid bodies revealed its requirement for development of mesoderm, endoderm, and ectoderm tissue lineages, and uncovered many genes whose activation or repression are Bptf-dependent. We also provide functional and physical links between the Bptf-containing NURF complex and the Smad transcription factors. These results suggest that Bptf may co-regulate some gene targets of this pathway, which is essential for establishment of the visceral endoderm. We conclude that Bptf likely regulates genes and signaling pathways essential for the development of key tissues of the early mouse embryo.

Access to Document (DOI)

Maintenance of undifferentiated mouse embryonic stem cells in suspension by the serum- and feeder-free defined culture condition

Tsuji Yukiiko, Yoshimura Naoko, Aoki Hitomi, Sharov Alexei A., Ko Minoru S H, Motohashi Tsutomu, Kunisada Takahiro

Developmental Dynamics 237 （ 8 ） 2129 - 2138 2008年08月

ISSN 1058-8388

The proven pluripotency of ES cells is expected to allow their therapeutic use for regenerative medicine. We present here a novel suspension culture method that facilitates the proliferation of pluripotent ES cells without feeder cells. The culture medium contains polyvinyl alcohol (PVA), free of either animal-derived or synthetic serum, and contains very low amounts of peptidic or proteinaceous materials, which are favorable for therapeutic use. ES cells showed sustained proliferation in the suspension culture, and their undifferentiated state and pluripotency were experimentally verified. DNA microarray analyses showed a close relationship between the elevated expression of genes related to cell adhesions. We suggest that this suspension culture condition provides a better alternative to the conventional attached cell culture condition, especially for possible therapeutic use, by limiting the exposure of ES cells to feeder cells and animal products. © 2008 Wiley-Liss, Inc.

Access to Document (DOI)

Effects of aging and calorie restriction on the global gene expression profiles of mouse testis and ovary

Sharov Alexei A., Falco Geppino, Piao Yulan, Poosala Suresh, Becker Kevin G., Zonderman Alan B., Longo Dan L., Schlessinger David, Ko Minoru S H

BMC Biology 6 2008年06月

Background: The aging of reproductive organs is not only a major social issue, but of special interest in aging research. A long-standing view of 'immortal germ line versus mortal soma' poses an important question of whether the reproductive tissues age in similar ways to the somatic tissues. As a first step to understand this phenomenon, we examine global changes in gene expression patterns by DNA microarrays in ovaries and testes of C57BL/6 mice at 1, 6, 16, and 24 months of age. In addition, we compared a group of mice on ad libitum (AL) feeding with a group on lifespan-extending 40% calorie restriction (CR). Results: We found that gene expression changes occurred in aging gonads, but were generally different from those in somatic organs during aging. For example, only two functional categories of genes previously associated with aging in muscle, kidney, and brain were confirmed in ovary: genes associated with complement activation were upregulated, and genes associated with mitochondrial electron transport were downregulated. The bulk of the changes in gonads were mostly related to gonad-specific functions. Ovaries showed extensive gene expression changes with age, especially in the period when ovulation ceases (from 6 to 16 months), whereas testes showed only limited age-related changes. The same trend was seen for the effects of CR: CR-mediated reversal of age-associated gene expression changes, reported in somatic organs previously, was limited to a small number of genes in gonads. Instead, in both ovary and testis, CR caused small and mostly gonad-specific effects: suppression of ovulation in ovary and activation of testis-specific genes in testis. Conclusion: Overall, the results are consistent with unique modes of aging and its modification by CR in testis and ovary. © 2008 Sharov et al; licensee BioMed Central Ltd.

Access to Document (DOI)

Identification of Pou5f1, Sox2, and Nanog downstream target genes with statistical confidence by applying a novel algorithm to time course microarray and genome-wide chromatin immunoprecipitation data

Sharov Alexei A., Masui Shinji, Sharova Lioudmila V., Piao Yulan, Aiba Kazuhiro, Matoba Ryo, Xin Li, Niwa Hitoshi, Ko Minoru S H

BMC Genomics 9 2008年06月

ISSN 1471-2164

Background: Target genes of a transcription factor (TF) Pou5f1 (Oct3/4 or Oct4), which is essential for pluripotency maintenance and self-renewal of embryonic stem (ES) cells, have previously been identified based on their response to Pou5f1 manipulation and occurrence of Chromatin-immunoprecipitation (ChIP)-binding sites in promoters. However, many responding genes with binding sites may not be direct targets because response may be mediated by other genes and ChIP-binding site may not be functional in terms of transcription regulation. Results: To reduce the number of false positives, we propose to separate responding genes into groups according to direction, magnitude, and time of response, and to apply the false discovery rate (FDR) criterion to each group individually. Using this novel algorithm with stringent statistical criteria (FDR < 0.2) to a compendium of published and new microarray data (3, 6, 12, and 24 hr after Pou5f1 suppression) and published ChIP data, we identified 420 tentative target genes (TTGs) for Pou5f1. The majority of TTGs (372) were down-regulated after Pou5f1 suppression, indicating that the Pou5f1 functions as an activator of gene expression when it binds to promoters. Interestingly, many activated genes are potent suppressors of transcription, which include polycomb genes, zinc finger TFs, chromatin remodeling factors, and suppressors of signaling. Similar analysis showed that Sox2 and Nanog also function mostly as transcription activators in cooperation with Pou5f1. Conclusion: We have identified the most reliable sets of direct target genes for key pluripotency genes - Pou5f1, Sox2, and Nanog, and found that they predominantly function as activators of downstream gene expression. Thus, most genes related to cell differentiation are suppressed indirectly. © 2008 Sharov et al; licensee BioMed Central Ltd.

Access to Document (DOI)

BAF250B-associated SWI/SNF chromatin-remodeling complex is required to maintain undifferentiated mouse embryonic stem cells

Yan Zhijiang, Wang Zhong, Sharova Lioudmila, Sharov Alexei A., Ling Chen, Piao Yulan, Aiba Kazuhiro, Matoba Ryo, Wang Weidong, Ko Minoru S H

Stem Cells 26 （ 5 ） 1155 - 1165 2008年05月

ISSN 1066-5099

Whether SWI/SNF chromatin remodeling complexes play roles in embryonic stem (ES) cells remains unknown. Here we show that SWI/SNF complexes are present in mouse ES cells, and their composition is dynamically regulated upon induction of ES cell differentiation. For example, the SWI/SNF purified from undifferentiated ES cells contains a high level of BAF155 and a low level of BAF170 (both of which are homologs of yeast SWI3 protein), whereas that from differentiated cells contains nearly equal amounts of both. Moreover, the levels of BAF250A and BAF250B decrease during the differentiation of ES cells, whereas that of BRM increases. The altered expression of SWI/SNF components hinted that these complexes could play roles in ES cell maintenance or differentiation. We therefore generated ES cells with biallelic inactivation of BAF250B and found that these cells display a reduced proliferation rate and an abnormal cell cycle. Importantly, these cells are deficient in the self-renewal capacity of undifferentiated ES cells and exhibit certain phenotypes of differentiated cells, including reduced expression of several pluripotency-related genes and increased expression of some differentiation-related genes. These data suggest that the BAF250B-associated SWI/SNF is essential for mouse ES cells to maintain their normal proliferation and pluripotency. The work presented here underscores the importance of SWI/SNF chromatin remodeling complexes in pluripotent stem cells. ©AlphaMed Press.

Access to Document (DOI)

Comparative analysis of oocyte transcript profiles reveals a high degree of conservation among species

Vallée Maud, Aiba Kazuhiro, Piao Yulan, Palin Marie France, Ko Minoru S H, Sirard Marc André

Reproduction 135 （ 4 ） 439 - 448 2008年04月

ISSN 1470-1626

Cross-species comparison of gene expression is a powerful approach for discovering genes that have been conserved throughout evolution. Conserved genes are presumably very important in the mechanisms related to the unique molecular functions in oocytes. The objective of this study was to identify genes expressed in the oocyte and conserved across three diverse vertebrate species. We report the global gene expression profiles of Bos taurus and Xenopus laevis oocytes on an NIA mouse development microarray that consists of 60-mer oligonucleotide probes representing more than 20 000 mouse transcripts derived from stem cell, oocyte, and early embryo cDNA libraries. Analysis based on intensity values revealed that 9853 and 10 046 genes are expressed in bovine and Xenopus oocytes respectively. Furthermore, previously published microarray data on preimplantation development in the mouse were used for a comparative analysis of global oocyte gene expression profiles. Interestingly, a substantial proportion of the genes expressed in mouse oocytes is conserved between the three species (74%, 7275 genes). Moreover, functional annotation of these conserved oocyte-expressed genes confirmed that certain functions are conserved among the three species. RNA metabolism and cell cycle were among the over-represented Gene Ontology terms in the biological process category. Finally, a pattern-matching analysis identified 208 conserved maternally expressed genes. Results from these cross-species hybridizations allowed numerous genes expressed in oocytes and conserved between Mus musculus, B. taurus, and X. laevis to be identified. This comparative analysis of oocyte transcript profiles revealed a high degree of conservation among species. © 2008 Society for Reproduction and Fertility.

Access to Document (DOI)

An in situ hybridization-based screen for heterogeneously expressed genes in mouse ES cells

Carter Mark G., Stagg Carole A., Falco Geppino, Yoshikawa Toshiyuki, Bassey Uwem C., Aiba Kazuhiro, Sharova Lioudmila V., Shaik Nabeebi, Ko Minoru S H

Gene Expression Patterns 8 （ 3 ） 181 - 198 2008年02月

ISSN 1567-133X

We previously reported that Zscan4 showed heterogeneous expression patterns in mouse embryonic stem (ES) cells. To identify genes that show similar expression patterns, we carried out high-throughput in situ hybridization assays on ES cell cultures for 244 genes. Most of the genes are involved in transcriptional regulation, and were selected using microarray-based comparisons of gene expression profiles in ES and embryonal carcinoma (EC) cells versus differentiated cell types. Pou5f1 (Oct4, Oct3/4) and Krt8 (EndoA) were used as controls. Hybridization signals were detected on ES cell colonies for 147 genes (60%). The majority (136 genes) of them showed relatively homogeneous expression in ES cell colonies. However, we found that two genes unequivocally showed Zscan4-like spotted expression pattern (spot-in-colony pattern; Whsc2 and Rhox9). We also found that nine genes showed relatively heterogeneous expression pattern (mosaic-in-colony pattern: Zfp42/Rex1, Rest, Atf4, Pa2g4, E2f2, Nanog, Dppa3/Pgc7/Stella, Esrrb, and Fscn1). Among these genes, Zfp42/Rex1 showed unequivocally heterogeneous expression in individual ES cells prepared by the CytoSpin. These results show the presence of different types or states of cells within ES cell cultures otherwise thought to be undifferentiated and homogeneous, suggesting a previously unappreciated complexity in ES cell cultures.

Access to Document (DOI)

Rex1/Zfp42 is dispensable for pluripotency in mouse ES cells

Masui Shinji, Ohtsuka Satoshi, Yagi Rika, Takahashi Kadue, Ko Minoru S H, Niwa Hitoshi

BMC Developmental Biology 8 2008年

Background. Rex1/Zfp42 has been extensively used as a marker for the undifferentiated state of pluripotent stem cells. However, its function in pluripotent stem cells including embryonic stem (ES) cells remained unclear although its involvement in visceral endoderm differentiation in F9 embryonal carcinoma (EC) cells was reported. Results. We showed the function of Rex1 in mouse ES cells as well as in embryos using the conventional gene targeting strategy. Our results clearly indicated that Rex1 function is dispensable for both the maintenance of pluripotency in ES cells and the development of embryos. However, Rex1-/- ES cells showed the defect to induce a subset of the marker genes of visceral endoderm, when differentiated as embryoid body, as found in EC cells. Conclusion. Rex1 should be regarded just as a marker of pluripotency without functional significance like the activity of alkaline phosphatase. © 2008 Masui et al; licensee BioMed Central Ltd.

Access to Document (DOI)

Enhanced sensitivity to IGF-II signaling links loss of imprinting of IGF2 to increased cell proliferation and tumor risk

Kaneda Atsushi, Wang Chiaochun J., Cheong Raymond, Timp Winston, Onyango Patrick, Wen Bo, Iacobuzio-Donahue Christine A., Ohlsson Rolf, Andraos Rita, Pearson Mark A., Sharov Alexei A., Longo Dan L., Ko Minoru S H, Levchenko Andre, Feinberg Andrew P.

Proceedings of the National Academy of Sciences of the United States of America 104 （ 52 ） 20926 - 20931 2007年12月

ISSN 0027-8424

Loss of imprinting (LOI) of the insulin-like growth factor-II gene (IGF2), leading to abnormal activation of the normally silent maternal allele, is a common human epigenetic population variant associated with a 5-fold increased frequency of colorectal neoplasia. Here, we show first that LOI leads specifically to increased expression of proliferation-related genes in mouse intestinal crypts. Surprisingly, LOI(+) mice also have enhanced sensitivity to IGF-II signaling, not simply increased IGF-II levels, because in vivo blockade with NVP-AEW541, a specific inhibitor of the IGF-II signaling receptor, showed reduction of proliferation-related gene expression to levels half that seen in LOI(-) mice. Signal transduction assays in microfluidic chips confirmed this enhanced sensitivity with marked augmentation of Akt/PKB signaling in LOI(+) cells at low doses of IGF-II, which was reduced in the presence of the inhibitor to levels below those found in LOI(-) cells, and was associated with increased expression of the IGF1 and insulin receptor genes. We exploited this increased IGF-II sensitivity to develop an in vivo chemopreventive strategy using the azoxymethane (AOM) mutagenesis model. LOI(+) mice treated with AOM showed a 60% increase in premalignant aberrant crypt foci (ACF) formation over LOI(-) mice. In vivo IGF-II blockade with NVP-AEW541 abrogated this effect, reducing ACF to a level 30% lower even than found in exposed LOI(-) mice. Thus, LOI increases cancer risk in a counterintuitive way, by increasing the sensitivity of the IGF-II signaling pathway itself, providing a previously undescribed epigenetic chemoprevention strategy in which cells with LOI are "IGF-II addicted" and undergo reduced tumorigenesis in the colon upon IGF-II pathway blockade. © 2007 by The National Academy of Sciences of the USA.

Access to Document (DOI)

AGEMAP

Zahn Jacob M., Poosala Suresh, Owen Art B., Ingram Donald K., Lustig Ana, Carter Arnell, Weeraratna Ashani T., Taub Dennis D., Gorospe Myriam, Mazan-Mamczarz Krystyna, Lakatta Edward G., Boheler Kenneth R., Xu Xiangru, Mattson Mark P., Falco Geppino, Ko Minoru S H, Schlessinger David, Firman Jeffrey, Kummerfeld Sarah K., Wood William H., Zonderman Alan B., Kim Stuart K., Becker Kevin G.

PLoS Genetics 3 （ 11 ） 2326 - 2337 2007年11月

ISSN 1553-7390

We present the AGEMAP (Atlas of Gene Expression in Mouse Aging Project) gene expression database, which is a resource that catalogs changes in gene expression as a function of age in mice. The AGEMAP database includes expression changes for 8,932 genes in 16 tissues as a function of age. We found great heterogeneity in the amount of transcriptional changes with age in different tissues. Some tissues displayed large transcriptional differences in old mice, suggesting that these tissues may contribute strongly to organismal decline. Other tissues showed few or no changes in expression with age, indicating strong levels of homeostasis throughout life. Based on the pattern of agerelated transcriptional changes, we found that tissues could be classified into one of three aging processes: (1) a pattern common to neural tissues, (2) a pattern for vascular tissues, and (3) a pattern for steroid-responsive tissues. We observed that different tissues age in a coordinated fashion in individual mice, such that certain mice exhibit rapid aging, whereas others exhibit slow aging for multiple tissues. Finally, we compared the transcriptional profiles for aging in mice to those from humans, flies, and worms. We found that genes involved in the electron transport chain show common age regulation in all four species, indicating that these genes may be exceptionally good markers of aging. However, we saw no overall correlation of age regulation between mice and humans, suggesting that aging processes in mice and humans may be fundamentally different.

Access to Document (DOI)

Human ES Cell Profiling Broadens the Reach of Bivalent Domains

Sharov Alexei A., Ko Minoru S H

Cell Stem Cell 1 （ 3 ） 237 - 238 2007年09月

ISSN 1934-5909

Access to Document (DOI)

Global gene expression profiling reveals similarities and differences among mouse pluripotent stem cells of different origins and strains

Sharova Lioudmila V., Sharov Alexei A., Piao Yulan, Shaik Nabeebi, Sullivan Terry, Stewart Colin L., Hogan Brigid L M, Ko Minoru S H

Developmental Biology 307 （ 2 ） 446 - 459 2007年07月

ISSN 0012-1606

Pluripotent stem cell lines with similar phenotypes can be derived from both blastocysts (embryonic stem cells, ESC) and primordial germ cells (embryonic germ cells, EGC). Here, we present a compendium DNA microarray analysis of multiple mouse ESCs and EGCs from different genetic backgrounds (strains 129 and C57BL/6) cultured under standard conditions and in differentiation-promoting conditions by the withdrawal of Leukemia Inhibitory Factor (LIF) or treatment with retinoic acid (RA). All pluripotent cell lines showed similar gene expression patterns, which separated them clearly from other tissue stem cells with lower developmental potency. Differences between pluripotent lines derived from different sources (ESC vs. EGC) were smaller than differences between lines derived from different mouse strains (129 vs. C57BL/6). Even in the differentiation-promoting conditions, these pluripotent cells showed the same general trends of gene expression changes regardless of their origin and genetic background. These data indicate that ESCs and EGCs are indistinguishable based on global gene expression patterns alone. On the other hand, a detailed comparison between a group of ESC lines and a group of EGC lines identified 20 signature genes whose average expression levels were consistently higher in ESC lines, and 84 signature genes whose average expression levels were consistently higher in EGC lines, irrespective of mouse strains. Similar analysis identified 250 signature genes whose average expression levels were consistently higher in a group of 129 cell lines, and 337 signature genes whose average expression levels were consistently higher in a group of C57BL/6 cell lines. Although none of the genes was exclusively expressed in either ESCs versus EGCs or 129 versus C57BL/6, in combination these signature genes provide a reliable separation and identification of each cell type. Differentiation-promoting conditions also revealed some minor differences between the cell lines. For example, in the presence of RA, EGCs showed a lower expression of muscle- and cardiac-related genes and a higher expression of gonad-related genes than ESCs. Taken together, the results provide a rich source of information about the similarities and differences between ESCs and EGCs as well as 129 lines and C57BL/6 lines. Such information will be crucial to our understanding of pluripotent stem cells. The results also underscore the importance of studying multiple cell lines from different strains when making comparisons based on gene expression analysis. © 2007 Elsevier Inc. All rights reserved.

Access to Document (DOI)

Zscan4

Falco Geppino, Lee Sung Lim, Stanghellini Ilaria, Bassey Uwem C., Hamatani Toshio, Ko Minoru S H

Developmental Biology 307 （ 2 ） 539 - 550 2007年07月

ISSN 0012-1606

The first wave of transcription, called zygotic genome activation (ZGA), begins during the 2-cell stage in mouse preimplantation development and marks a vital transition from the maternal genetic to the embryonic genetic program. Utilizing DNA microarray data, we looked for genes that are expressed only during ZGA and found Zscan4, whose expression is restricted to late 2-cell stage embryos. Sequence analysis of genomic DNA and cDNA clones revealed nine paralogous genes tightly clustered in 0.85 Mb on mouse chromosome 7. Three genes are not transcribed and are thus considered pseudogenes. Among the six expressed genes named Zscan4a-Zscan4f, three - Zscan4c, Zscan4d, and Zscan4f - encode full-length ORFs with 506 amino acids. Zscan4d is a predominant transcript at the late 2-cell stage, whereas Zscan4c is a predominant transcript in embryonic stem (ES) cells. No transcripts of any Zscan4 genes are detected in any other cell types. Reduction of Zscan4 transcript levels by siRNAs delays the progression from the 2-cell to the 4-cell stage and produces blastocysts that fail to implant or proliferate in blastocyst outgrowth culture. Zscan4 thus seems to be essential for preimplantation development.

Access to Document (DOI)

Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells

Masui Shinji, Nakatake Yuhki, Toyooka Yayoi, Shimosato Daisuke, Yagi Rika, Takahashi Kazue, Okochi Hitoshi, Okuda Akihiko, Matoba Ryo, Sharov Alexei A., Ko Minoru S H, Niwa Hitoshi

Nature Cell Biology 9 （ 6 ） 625 - 635 2007年06月

ISSN 1465-7392

The pluripotency of embryonic stem (ES) cells is thought to be maintained by a few key transcription factors, including Oct3/4 and Sox2. The function of Oct3/4 in ES cells has been extensively characterized, but that of Sox2 has yet to be determined. Sox2 can act synergistically with Oct3/4 in vitro to activate Oct-Sox enhancers, which regulate the expression of pluripotent stem cell-specific genes, including Nanog, Oct3/4 and Sox2 itself. These findings suggest that Sox2 is required by ES cells for its Oct-Sox enhancer activity. Using inducible Sox2-null mouse ES cells, we show that Sox2 is dispensable for the activation of these Oct-Sox enhancers. In contrast, we demonstrate that Sox2 is necessary for regulating multiple transcription factors that affect Oct3/4 expression and that the forced expression of Oct3/4 rescues the pluripotency of Sox2-null ES cells. These results indicate that the essential function of Sox2 is to stabilize ES cells in a pluripotent state by maintaining the requisite level of Oct3/4 expression.

Access to Document (DOI)

Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity

Ulloa-Montoya Fernando, Kidder Benjamin L., Pauwelyn Karen A., Chase Lucas G., Luttun Aernout, Crabbe Annelies, Geraerts Martine, Sharov Alexei A., Piao Yulan, Ko Minoru S H, Hu Wei Shou, Verfaillie Catherine M.

Genome Biology 8 （ 8 ） 2007年

ISSN 1474-7596

Background: Recently, several populations of postnatal stem cells, such as multipotent adult progenitor cells (MAPCs), have been described that have broader differentiation ability than classical adult stem cells. Here we compare the transcriptome of pluripotent embryonic stem cells (ESCs), MAPCs, and lineage-restricted mesenchymal stem cells (MSCs) to determine their relationship. Results: Applying principal component analysis, non-negative matrix factorization and k-means clustering algorithms to the gene-expression data, we identified a unique gene-expression profile for MAPCs. Apart from the ESC-specific transcription factor Oct4 and other ESC transcripts, some of them associated with maintaining ESC pluripotency, MAPCs also express transcripts characteristic of early endoderm and mesoderm. MAPCs do not, however, express Nanog or Sox2, two other key transcription factors involved in maintaining ESC properties. This unique molecular signature was seen irrespective of the microarray platform used and was very similar for both mouse and rat MAPCs. As MSC-like cells isolated under MAPC conditions are virtually identical to MSCs, and MSCs cultured in MAPC conditions do not upregulate MAPC-expressed transcripts, the MAPC signature is cell-type specific and not merely the result of differing culture conditions. Conclusion: Multivariate analysis techniques clustered stem cells on the basis of their expressed gene profile, and the genes determining this clustering reflected the stem cells' differentiation potential in vitro. This comparative transcriptome analysis should significantly aid the isolation and culture of MAPCs and MAPC-like cells, and form the basis for studies to gain insights into genes that confer on these cells their greater developmental potency. © 2007 Ulloa-Montoya et al.; licensee BioMed Central Ltd.

Access to Document (DOI)

Dissecting Oct3/4-regulated gene networks in embryonic stem cells by expression profiling

Matoba Ryo, Niwa Hitoshi, Masui Shinji, Ohtsuka Satoshi, Carter Mark G., Sharov Alexei A., Ko Minoru S H

PLoS ONE 1 （ 1 ） 2006年12月

POU transcription factor Pou5f1 (Oct3/4) is required to maintain ES cells in an undifferentiated state. Here we show that global expression profiling of Oct3/4-manipulated ES cells delineates the downstream target genes of Oct3/4. Combined with data from genome-wide chromatin-immunoprecipitation (ChIP) assays, this analysis identifies not only primary downstream targets of Oct3/4, but also secondary or tertiary targets. Furthermore, the analysis also reveals that downstream target genes are regulated either positively or negatively by Oct3/4. Identification of a group of genes that show both activation and repression depending on Oct3/4 expression levels provides a possible mechanism for the requirement of appropriate Oct3/4 expression to maintain undifferentiated ES cells. As a proof-of-principle study, one of the downstream genes, Tcl1, has been analyzed in detail. We show that Oct3/4 binds to the promoter region of Tcl1 and activates its transcription. We also show that Tcl1 is involved in the regulation of proliferation, but not differentiation, in ES cells. These findings suggest that the global expression profiling of gene-manipulated ES cells can help to delineate the structure and dynamics of gene regulatory networks.

Access to Document (DOI)

Genomic approaches to early embryogenesis and stem cell biology

Aiba Kazuhiro, Carter Mark G., Matoba Ryo, Ko Minoru S H

Seminars in Reproductive Medicine 24 （ 5 ） 330 - 339 2006年11月

ISSN 1526-8004

Large-scale systematic gene expression analyses of early embryos and stem cells provide useful information to identify genes expressed differentially or uniquely in these cells. We review the current status of various approaches applied to preimplantation embryos and stem cells: expressed sequence tag, serial analysis of gene expression, differential display, massively parallel signature sequencing, DNA microarray (DNA chip) analysis, and chromatin-immunoprecipitation microarrays. We also discuss the biological questions that can only be addressed by the analysis of global gene expression patterns, such as so-called stemness and developmental potency. As the emphasis now shifts from expression profiling to functional studies, we review the genome-scale functional studies of genes: expression cloning, gene trapping, RNA interference, and gene disruptions. Finally, we discuss the future clinical application of such methodologies.

Access to Document (DOI)

Klf4 cooperates with Oct3/4 and Sox2 to activate the Lefty1 core promoter in embryonic stem cells

Nakatake Yuhki, Fukui Nobutaka, Iwamatsu Yuko, Masui Shinji, Takahashi Kadue, Yagi Rika, Yagi Kiyohito, Miyazaki Jun Ichi, Matoba Ryo, Ko Minoru S H, Niwa Hitoshi

Molecular and Cellular Biology 26 （ 20 ） 7772 - 7782 2006年10月

ISSN 0270-7306

Although the POU transcription factor Oct3/4 is pivotal in maintaining self renewal of embryonic stem (ES) cells, little is known of its molecular mechanisms. We previously reported that the N-terminal transactivation domain of Oct3/4 is required for activation of Lefty1 expression (H. Niwa, S. Masui, I. Chambers, A. G. Smith, and J. Miyazaki, Mol. Cell. Biol. 22:1526-1536, 2002). Here we test whether Lefty1 is a direct target of Oct3/4. We identified an ES cell-specific enhancer upstream of the Lefty1 promoter that contains binding sites for Oct3/4 and Sox2. Unlike other known Oct3/4-Sox2-dependent enhancers, however, this enhancer element could not be activated by Oct3/4 and Sox2 in differentiated cells. By functional screening of ES-specific transcription factors, we found that Krüppel-like factor 4 (Klf4) cooperates with Oct3/4 and Sox2 to activate Lefty1 expression, and that Klf4 acts as a mediating factor that specifically binds to the proximal element of the Lefty1 promoter. DNA microarray analysis revealed that a subset of putative Oct3/4 target genes may be regulated in the same manner. Our findings shed light on a novel function of Oct3/4 in ES cells. Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Access to Document (DOI)

Use of Chuk as an internal standard suitable for quantitative RT-PCR in mouse preimplantation embryos

Falco Geppino, Stanghellini Ilaria, Ko Minoru S H

Reproductive BioMedicine Online 13 （ 3 ） 394 - 403 2006年09月

ISSN 1472-6483

Analysis of gene expression changes during preimplantation development by quantitative reverse transcription-polymerase chain reaction (Q-PCR) requires appropriate internal standards. Ideally, such a gene should show a constant level of transcripts per embryo across all preimplantation stages from unfertilized eggs to blastocysts. By analysing the microarray-based gene expression profiles of preimplantation embryos, it was found that a conserved helix-loop-helix ubiquitous kinase gene (Chuk, also known as IκB kinase α, IKKα or IKK1) satisfied this criterion. To test the utility of this gene as an internal standard for Q-PCR, the expression levels of two known genes (Nalp5/Mater, Pou5f1/Oct3/Oct4) were normalized by Chuk and other housekeeping genes (Actb, Gapdh, Eef1a1, and H2afz) and demonstrated that the former was more consistent with the expression patterns obtained by a whole-mount in-situ hybridization than those reported previously with the latter. It is concluded that Chuk, unlike other commonly used normalization controls, is a reliable and suitable internal standard for measuring gene expression levels by Q-PCR in mouse oocytes and preimplantation embryos.

Expression profiling of the mouse early embryo

Ko Minoru S H

Developmental Dynamics 235 （ 9 ） 2437 - 2448 2006年09月

ISSN 1058-8388

The laboratory mouse model plays important roles in our understanding of early mammalian development and provides an invaluable model for human early embryos, which are difficult to study for ethical and technical reasons. A comprehensive collection of cDNA clones, their sequences, and complete genome sequence information, which have been accumulated over the past two decades, reveal even further the value of the mouse models. Here, the progress in global gene expression profiling in early mouse embryos and, to some extent, stem cells is reviewed and future directions and challenges are discussed. The discussions include the restatement of global gene expression profiles as a snapshot of cellular status, and subsequent distinction between the differentiation state and physiological state of the cells. The discussions then extend to the biological problems that can be addressed only through global expression profiling, including a bird's-eye view of global gene expression changes, molecular index for developmental potency, cell lineage trajectory, microarray-guided cell manipulation, and the possibility of delineating gene regulatory cascades and networks.

Access to Document (DOI)

Global gene expression profiling of preimplantation embryos.

Hamatani Toshio, Ko Minoru Sh, Yamada Mitsutoshi, Kuji Naoaki, Mizusawa Yuri, Shoji Mayumi, Hada Tomonori, Asada Hironori, Maruyama Tetsuo, Yoshimura Yasunori

Human cell : official journal of Human Cell Research Society 19 （ 3 ） 98 - 117 2006年08月

ISSN 0914-7470

Preimplantation development is marked by four major events: the transition of maternal transcripts to zygotic transcripts, compaction, the first lineage differentiation into inner cell mass and trophectoderm, and implantation. The scarcity of the materials of preimplantation embryos, both in size (diameter < 100 microm) and in quantity (only a few to tens of oocytes from each ovulation), has hampered molecular analysis of preimplantation embryos. Recent progress in RNA amplification methods and microarray platforms, including genes unique to preimplantation embryos, allow us to apply global gene expression profiling to the study of preimplantation embryos. Our gene expression profiling during preimplantation development revealed the distinctive patterns of maternal RNA degradation and embryonic gene activation, including two major transient waves of de novo transcription. The first wave corresponds to zygotic genome activation (ZGA). The second wave, mid-preimplantation gene activation (MGA), contributes dramatic morphological changes during late preimplantation development. Further expression profiling of embryos treated with inhibitors of transcription or translation revealed that the translation of maternal RNA is required for the initiation of ZGA, suggesting a cascade of gene activation from maternal RNA/protein sets to ZGA gene sets and thence to MGA gene sets. To date, several reports of microarray experiments using mouse and human preimplantation embryos have been published. The identification of a large number of genes and multiple signaling pathways involved at each developmental stage by such global gene expression profiling accelerates understanding of molecular mechanisms underlining totipotency/pluripotency and programs of early mammalian development.

Esg1, expressed exclusively in preimplantation embryos, germline, and embryonic stem cells, is a putative RNA-binding protein with broad RNA targets

Tanaka Tetsuya S., De Silanes Isabel Lopez, Sharova Lioudmila V., Akutsu Hidenori, Yoshikawa Toshiyuki, Amano Hisayuki, Yamanaka Shinya, Gorospe Myriam, Ko Minoru S H

Development Growth and Differentiation 48 （ 6 ） 381 - 390 2006年08月

ISSN 0012-1592

In our earlier attempt to identify genes involved in the maintenance of cellular pluripotency, we found that KH-domain protein Embryonal stem cell-specific gene 1 (Esg1) showed similar expression patterns to those of Oct3/4 (Pou5f1), whereas the forced repression of Oct3/4 in mouse embryonic stem cells immediately downregulated the expression of Esg1. Here we further confirm this overlap by in situ hybridization and immunohistochemical analyses. Both Esg1 transcript and protein exist in the egg and preimplantation embryos. At embryonic day 3.5, blastocyst stage, however, ESG1 protein was more abundant in the inner cell mass (ICM) than in trophectoderm (TE), whereas Esg1 transcript was detected in both the ICM and the TE, particularly in the polar trophectoderm. The presence of an RNA-binding KH-domain in ESG1 led us to search for and identify 902 target transcripts by microarray analysis of immunoprecipitated ESG1 complex. Interaction of 20 target mRNA with ESG1, including Cdc25a, Cdc42, Ezh2, Nfyc and Nr5a2. was further validated by reverse transcriptase-polymerase chain reaction of the immunoprecipitation material, supporting the notion that ESG1 is an RNA-binding protein which associates with specific target transcripts. © 2006 Japanese Society of Developmental Biologists.

Access to Document (DOI)

The absence of a Ca²⁺ signal during mouse egg activation can affect parthenogenetic preimplantation development, gene expression patterns, and blastocyst quality

Rogers N. T., Halet G., Piao Y., Carroll J., Ko M. S H, Swann K.

Reproduction 132 （ 1 ） 45 - 57 2006年07月

ISSN 1470-1626

A series of Ca²⁺ oscillations during mammalian fertilization is necessary and sufficient to stimulate meiotic resumption and pronuclear formation. It is not known how effectively development continues in the absence of the initial Ca²⁺ signal. We have triggered parthenogenetic egg activation with cycloheximide that causes no Ca²⁺ increase, with ethanol that causes a single large Ca²⁺ increase, or with Sr²⁺ that causes Ca²⁺ oscillations. Eggs were co-treated with cytochalasin D to make them diploid and they formed pronuclei and two-cell embryos at high rates with each activation treatment. However, far fewer of the embryos that were activated by cycloheximide reached the blastocyst stage compared to those activated by Sr²⁺ or ethanol. Any cycloheximide-activated embryos that reached the blastocyst stage had a smaller inner cell mass number and a greater rate of apoptosis than Sr²⁺ -activated embryos. The poor development of cycloheximide-activated embryos was due to the lack of Ca²⁺ increase because they developed to blastocyst stages at high rates when co-treated with Sr²⁺ or ethanol. Embryos activated by either Sr²⁺ or cycloheximide showed similar signs of initial embryonic genome activation (EGA) when measured using a reporter gene. However, microarray analysis of gene expression at the eight-cell stage showed that activation by Sr²⁺ leads to a distinct pattern of gene expression from that seen with embryos activated by cycloheximide. These data suggest that activation of mouse eggs in the absence of a Ca²⁺ signal does not affect initial parthenogenetic events, but can influence later gene expression and development. © 2006 Society for Reproduction and Fertility.

Access to Document (DOI)

Defining a developmental path to neural fate by global expression profiling of mouse embryonic stem cells and adult neural stem/progenitor cells

Aiba Kazuhiro, Sharov Alexei A., Carter Mark G., Foroni Chiara, Vescovi Angelo L., Ko Minoru S H

Stem Cells 24 （ 4 ） 889 - 895 2006年04月

ISSN 1066-5099

To understand global features of gene expression changes during in vitro neural differentiation, we carried out the microarray analysis of embryonic stem cells (ESCs), embryonal carcinoma cells, and adult neural stem/progenitor (NS) cells. Expression profiling of ESCs during differentiation in monolayer culture revealed three distinct phases: undifferentiated ESCs, primitive ectoderm-like cells, and neural progenitor cells. Principal component (PC) analysis revealed that these cells were aligned on PC1 over the course of 6 days. This PC1 represents approximately 4,000 genes, the expression of which increased with neural commitment/differentiation. Furthermore, NS cells derived from adult brain and their differentiated cells were positioned along this PC axis further away from undifferentiated ESCs than embryonic stem-derived neural progenitors. We suggest that this PC1 defines a path to neural fate, providing a scale for the degree of commitment/differentiation. ©AlphaMed Press.

Access to Document (DOI)

Gene expression changes at metamorphosis induced by thyroid hormone in Xenopus laevis tadpoles

Das Biswajit, Cai Liquan, Carter Mark G., Piao Yu Lan, Sharov Alexei A., Ko Minoru S H, Brown Donald D.

Developmental Biology 291 （ 2 ） 342 - 355 2006年03月

ISSN 0012-1606

Thyroid hormone (TH) controlled gene expression profiles have been studied in the tail, hind limb and brain tissues during TH-induced and spontaneous Xenopus laevis metamorphosis. Amplified cRNA probes mixed with a universal standard were hybridized to a set of 21,807-sense strand 60-mer oligonucleotides on each slide representing the entries in X. laevis UniGene Build 48. Most of the up-regulated genes in hind limb and brain are the same. This reflects in part the fact that the initial response to TH induction in both tissues is cell proliferation. A large number of up-regulated genes in the limb and brain programs encode common components of the cell cycle, DNA and RNA metabolism, transcription and translation. Notch is one of the few genes that is differentially expressed exclusively in the brain in the first 48 h of TH induction studied in these experiments. The TH-induced gene expression changes in the tail are different from the limb and brain programs. Distinct muscle and fibroblast programs were identified in the tail. Dying muscle fibers in tail (marked by active caspase-3) up-regulate a group of genes that include proteolytic enzymes. At the climax of metamorphosis, tail muscle down-regulates more than half of the genes that encode the glycolytic enzymes in the cytoplasm and the tricarboxylic acid pathway and all five complexes of the electron transport system in mitochondria. These changes in gene expression precede the activation of caspase-3. Some of these same energy metabolism-related genes are up-regulated in the limb and brain programs by TH. A prominent feature of the tail fibroblasts is the down-regulation of several collagen and other extra cellular matrix genes and the up-regulation of hydrolytic enzymes that are responsible for dissolving the notochord and resorbing the tail. © 2005 Elsevier Inc. All rights reserved.

Access to Document (DOI)

Epigenetics of germ cells, stem cells, and early embryos

Ko Minoru S H, McLaren Anne

Developmental Cell 10 （ 2 ） 161 - 166 2006年02月

ISSN 1534-5807

Access to Document (DOI)

Meet our Editor

Ko Minoru S H

Reproductive BioMedicine Online 12 （ 2 ） 143 2006年02月

ISSN 1472-6483

The multifunctional RNA-binding protein La is required for mouse development and for the establishment of embryonic stem cells

Park Jung Min, Kohn Matthew J., Bruinsma Monique W., Vech Claire, Intine Robert V., Fuhrmann Stacy, Grinberg Alex, Mukherjee Ipsita, Love Paul E., Ko Minoru S., DePamphilis Melvin L., Maraia Richard J.

Molecular and Cellular Biology 26 （ 4 ） 1445 - 1451 2006年02月

ISSN 0270-7306

The La protein is a target of autoantibodies in patients suffering from Sjögren's syndrome, systemic lupus erythematosus, and neonatal lupus. Ubiquitous in eukaryotes, La functions as a RNA-binding protein that promotes the maturation of tRNA precursors and other nascent transcripts synthesized by RNA polymerase III as well as other noncoding RNAs. La also associates with a class of mRNAs that encode ribosome subunits and precursors to snoRNAs involved in ribosome biogenesis. Thus, it was surprising that La is dispensable in the yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, the organisms from which it has been characterized most extensively. To determine whether La is essential in mammals and if so, at which developmental stage it is required, mice were created with a disrupted La gene, and the offspring from La ^+/- intercrosses were analyzed. La^-/- offspring were detected at the expected frequency among blastocysts prior to implantation, whereas no nullizygotes were detected after implantation, indicating that La is required early in development. Blastocysts derived from La^+/- intercrosses yielded 38 La^+/+ and La^+/- embryonic stem (ES) cell lines but no La^-/- ES cell lines, suggesting that La contributes a critical function toward the establishment or survival of ES cells. Consistent with this, La^-/- blastocyst outgrowths revealed loss of the inner cell mass (ICM). The results indicate that in contrast to the situation in yeasts, La is essential in mammals and is one of a limited number of genes required as early as the development of the ICM.

Access to Document (DOI)

High-throughput screen for genes predominantly expressed in the ICM of mouse blastocysts by whole mount in situ hybridization

Yoshikawa Toshiyuki, Piao Yulan, Zhong Jinhui, Matoba Ryo, Carter Mark G., Wang Yuxia, Goldberg Ilya, Ko Minoru S H

Gene Expression Patterns 6 （ 2 ） 213 - 224 2006年01月

ISSN 1567-133X

Mammalian preimplantation embryos provide an excellent opportunity to study temporal and spatial gene expression in whole mount in situ hybridization (WISH). However, large-scale studies are made difficult by the size of the embryos (∼60 μm diameter) and their fragility. We have developed a chamber system that allows parallel processing of embryos without the aid of a microscope. We first selected 91 candidate genes that were transcription factors highly expressed in blastocysts, and more highly expressed in embryonic (ES) than in trophoblast (TS) stem cells. We then used the WISH to identify 48 genes expressed predominantly in the inner cell mass (ICM) and to follow several of these genes in all seven preimplantation stages. The ICM-predominant expressions of these genes suggest their involvement in the pluripotency of embryonic cells. This system provides a useful tool to a systematic genome-scale analysis of preimplantation embryos.

Access to Document (DOI)

CisView

Sharov Alexei A., Dudekula Dawood B., Ko Minoru S H

DNA Research 13 （ 3 ） 123 - 134 2006年

ISSN 1340-2838

To facilitate the analysis of gene regulatory regions of the mouse genome, we developed a CisView (http:x//lgsun.grc.nia.nih.gov/cisview), a browser and database of genome-wide potential transcription factor binding sites (TFBSs) that were identified using 134 position-weight matrices and 219 sequence patterns from various sources and were presented with the information about sequence conservation, neighboring genes and their structures, GO annotations, protein domains, DNA repeats and CpG islands. Analysis of the distribution of TFBSs revealed that many TFBSs (N = 145) were over-represented near transcription start sites. We also identified potential cis-regulatory modules (CRMs) defined as clusters of conserved TFBSs in the entire mouse genome. Out of 739 074 CRMs, 157 442 had a significantly higher regulatory potential score than semi-random sequences generated with a 3rd-order Markov process. The CisView browser provides a user-friendly computer environment for studying transcription regulation on a whole-genome scale and can also be used for interpreting microarray experiments and identifying putative targets of transcription factors. © The Author 2006. Kazusa DNA Research Institute.

Access to Document (DOI)

Identification of target genes and a unique cis element regulated by IRF-8 in developing macrophages

Tamura Tomohiko, Thotakura Pratima, Tanaka Tetsuya S., Ko Minoru S H, Ozato Keiko

Blood 106 （ 6 ） 1938 - 1947 2005年09月

ISSN 0006-4971

Interferon regulatory factor-8 (IRF-8)/interferon consensus sequence-binding protein (ICSBP) is a transcription factor that controls myeloid-cell development. Microarray gene expression analysis of Irf-8 ^-/- myeloid progenitor cells expressing an IRF-8/estrogen receptor chimera (which differentiate into macrophages after addition of estradiol) was used to identify 69 genes altered by IRF-8 during early differentiation (62 up-regulated and 7 down-regulated). Among them, 4 lysosomal/endosomal enzyme-related genes (cystatin C, cathepsin C, lysozyme, and prosaposin) did not require de novo protein synthesis for induction, suggesting that they were direct targets of IRF-8. We developed a reporter assay system employing a self-inactivating retrovirus and analyzed the cystatin C and cathepsin C promoters. We found that a unique cis element mediates IRF-8-induced activation of both promoters. Similar elements were also found in other IRF-8 target genes with a consensus sequence (GAAANN[N]GGAA) comprising a core IRF-binding motif and an Ets-binding motif; this sequence is similar but distinct from the previously reported Ets/IRF composite element. Chromatin immunoprecipitation assays demonstrated that IRF-8 and the PU.1 Ets transcription factor bind to this element in vivo. Collectively, these data indicate that IRF-8 stimulates transcription of target genes through a novel cis element to specify macrophage differentiation. © 2005 by The American Society of Hematology.

Access to Document (DOI)

Identification of Zfp-57 as a downstream molecule of STAT3 and Oct-3/4 in embryonic stem cells

Akagi Tadayuki, Usuda Masayuki, Matsuda Takahiko, Ko Minoru S H, Niwa Hitoshi, Asano Masahide, Koide Hiroshi, Yokota Takashi

Biochemical and Biophysical Research Communications 331 （ 1 ） 23 - 30 2005年05月

ISSN 0006-291X

Embryonic stem (ES) cells are pluripotent cells derived from the inner cell mass of blastocysts. Transcription factor STAT3 is essential for the self-renewal of ES cells. In this study, we searched for downstream molecules of STAT3 in ES cells. Using DNA chip analysis, we obtained zinc finger protein (Zfp)-57. The expression of Zfp-57 was restricted to undifferentiated ES cells and activation of STAT3 led to expression of Zfp-57. We also found that forced expression of a dominant-negative mutant of STAT3 or repression of Oct-3/4 expression led to down-regulation of Zfp-57. Targeted disruption of Zfp-57 resulted in no gross phenotypical defects, including expression of undifferentiated-state-specific genes. These data suggest that Zfp-57 is a downstream molecule of STAT3 and Oct-3/4 in ES cells, although dispensable for their self-renewal. © 2005 Elsevier Inc. All rights reserved.

Access to Document (DOI)

A web-based tool for principal component and significance analysis of microarray data

Sharov Alexei A., Dudekula Dawood B., Ko Minoru S H

Bioinformatics 21 （ 10 ） 2548 - 2549 2005年05月

ISSN 1367-4803

Summary: We have developed a program for microarray data analysis, which features the false discovery rate for testing statistical significance and the principal component analysis using the singular value decomposition method for detecting the global trends of gene-expression patterns. Additional features include analysis of variance with multiple methods for error variance adjustment, correction of cross-channel correlation for two-color microarrays, identification of genes specific to each cluster of tissue samples, biplot of tissues and corresponding tissue-specific genes, clustering of genes that are correlated with each principal component (PC), three-dimensional graphics based on virtual reality modeling language and sharing of PC between different experiments. The software also supports parameter adjustment, gene search and graphical output of results. The software is implemented as a web tool and thus the speed of analysis does not depend on the power of a client computer. © The Author 2005. Published by Oxford University Press. All rights reserved.

Access to Document (DOI)

Genome-wide assembly and analysis of alternative transcripts in mouse

Sharov Alexei A., Dudekula Dawood B., Ko Minoru S H

Genome Research 15 （ 5 ） 748 - 754 2005年05月

ISSN 1088-9051

To build a mouse gene index with the most comprehensive coverage of alternative transcription/splicing (ATS), we developed an algorithm and a fully automated computational pipeline for transcript assembly from expressed sequences aligned to the genome. We identified 191,946 genomic loci, which included 27,497 protein-coding genes and 11,906 additional gene candidates (e.g., nonprotein-coding, but multiexon). Comparison of the resulting gene index with TIGR, UniGene, DoTS, and ESTGenes databases revealed that it had a greater number of transcripts, a greater average number of exons and introns with proper splicing sites per gene, and longer ORFs. The 27,497 protein-coding genes had 77,138 transcripts, i.e., 2.8 transcripts per gene on average. Close examination of transcripts led to a combinatorial table of 23 types of ATS units, only nine of which were previously described, i.e., 14 types of alternative splicing, seven types of alternative starts, and two types of alternative termination. The 47%, 18%, and 14% of 20,323 multiexon protein-coding genes with proper splice sites had alternative splicings, alternative starts, and alternative terminations, respectively. The gene index with the comprehensive ATS will provide a useful platform for analyzing the nature and mechanism of ATS, as well as for designing the accurate exon-based DNA microarrays. ©2005 by Cold Spring Harbor Laboratory Press.

Access to Document (DOI)

Loss of imprinting of Igf2 alters intestinal maturation and tumorigenesis in mice

Sakatani Takashi, Kaneda Atsushi, Iacobuzio-Donahue Christine A., Carter Mark G., De Boom Witzel Sten, Okano Hideyuki, Ko Minora S H, Ohlsson Rolf, Longo Dan L., Feinberg Andrew P.

Science 307 （ 5717 ） 1976 - 1978 2005年03月

ISSN 0036-8075

Loss of imprinting (LOI) of the insulin-like growth factor II gene (IGF2) is an epigenetic alteration that results in a modest increase in IGF2 expression, and it is present in the normal colonic mucosa of about 30% of patients with colorectal cancer. To investigate its role in intestinal tumorigenesis, we created a mouse model of Igf2 LOI by crossing female H19 ^+/- mice with male Apc^+/Min mice. Mice with LOI developed twice as many intestinal tumors as did control littermates. Notably, these mice also showed a shift toward a less differentiated normal intestinal epithelium, reflected by an increase in crypt length and increased staining with progenitor cell markers. A similar shift in differentiation was seen in the normal colonic mucosa of humans with LOI. Thus, altered maturation of nonneoplastic tissue may be one mechanism by which epigenetic changes affect cancer risk.

Access to Document (DOI)

Mouse ovary developmental RNA and protein markers from gene expression profiling

Herrera Luisa, Ottolenghi Chris, Garcia-Ortiz J. Elias, Pellegrini Massimo, Manini Francesca, Ko Minoru S H, Nagaraja Ramaiah, Forabosco Antonino, Schlessinger David

Developmental Biology 279 （ 2 ） 271 - 290 2005年03月

ISSN 0012-1606

To identify genes involved in morphogenetic events during mouse ovary development, we started with microarray analyses of whole organ RNA. Transcripts for 60% of the 15,000 gene NIA panel were detected, and about 2000 were differentially expressed in nascent newborn compared to adult ovary. Highly differentially expressed transcripts included noncoding RNAs and newly detected genes involved in transcription regulation and signal transduction. The phased pattern of newborn mouse ovary differentiation allowed us to (1) extend information on activity and stage specificity of cell type-specific genes; and (2) generate a list of candidate genes involved in primordial follicle formation, including podocalyxin (Podxl), PDGFR-β, and a follistatin-domain-encoding gene Flst1. Oocyte-specific transcripts included many (e.g., Deltex2, Bicd2, and Zfp37) enriched in growing oocytes, as well as a novel family of untranslated RNA's (RLTR10) that is selectively expressed in early stage follicles. The results indicate that global expression profiling of whole organ RNA provides sensitive first-line information about ovarian histogenesis for which no in vitro cell models are currently available.

Access to Document (DOI)

Discussion (day 2 session 2)

McMahan Jeff, Cohen Jacques, Ko Minoru, Johnson Martin, Robertson John, Murphy Timothy, Brinsden Peter, Hussein Fatima, Savulescu Julian, McLaren Anne, McLean Sheila, Harris John, Schulman Joe, Edwards Robert, Pedersen Roger, Stock Gregory, Grudzinskas Gedis, Boivin Jacky

Reproductive BioMedicine Online 10 （ SUPPL. 1 ） 107 - 110 2005年03月

ISSN 1472-6483

Epigenetics, I GF2 dosage and cancer risk

Kaneda [No Value], Feinberg [No Value], Iacobuzio-Donahue [No Value], Sakatani Takashi, Witzel Sten De Boom, Carter Mark, Ko Minoru, Longo Dan, Okano Hideyuki, Ohlsson [No Value]

Cancer Biology and Therapy 4 （ 3 ） 2005年03月

ISSN 1538-4047

Molecular biology of preimplantation embryos

Ko Minoru S H

Reproductive BioMedicine Online 10 （ SUPPL. 1 ） 80 - 87 2005年03月

ISSN 1472-6483

This article is based on a presentation at the First International Conference on Ethics, Science and Moral Philosophy of Assisted Human Reproduction. The goal is to provide scientific background for the discussion of philosophic issues. Recent advances in the systematic molecular analysis of preimplantation embryos are summarized, including the molecular identification of nearly all genes involved in preimplantation development and their detailed expression patterns. Notwithstanding a quantum leap in molecular understanding of preimplantation embryos, molecular evidence seems to provide no decisive definition of a threshold for the beginning of human life during preimplantation development. © 2005 Reproductive Healthcare Limited.

Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray.

Carter Mark G., Sharov Alexei A., VanBuren Vincent, Dudekula Dawood B., Carmack Condie E., Nelson Charlie, Ko Minoru S H

Genome biology 6 （ 7 ） 2005年

The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance.

Regulation of genome activity and genetic networks in mammals

VanBuren V., Ko M. S H

201 - 220 2004年12月

Age-associated alteration of gene expression patterns in mouse oocytes

Hamatani Toshio, Falco Geppino, Carter Mark G., Akutsu Hidenori, Stagg Carole A., Sharov Alexei A., Dudekula Dawood B., VanBuren Vincent, Ko Minoru S H

Human Molecular Genetics 13 （ 19 ） 2263 - 2278 2004年10月

ISSN 0964-6906

Decreasing oocyte competence with maternal aging is a major factor in human infertility. To investigate the age-dependent molecular changes in a mouse model, we compared the expression profiles of metaphase II oocytes collected from 5- to 6-week-old mice with those collected from 42- to 45-week-old mice using the NIA 22K 60-mer oligo microarray. Among approximately 11 000 genes whose transcripts were detected in oocytes, about 5% (530) showed statistically significant expression changes, excluding the possibility of global decline in transcript abundance. Consistent with the generally accepted view of aging, the differentially expressed genes included ones involved in mitochondrial function and oxidative stress. However, the expression of other genes involved in chromatin structure, DNA methylation, genome stability and RNA helicases was also altered, suggesting the existence of additional mechanisms for aging. Among the transcripts decreased with aging, we identified and characterized a group of new oocyte-specific genes, members of the human NACHT, leucine-rich repeat and PYD-containing (NALP) gene family. These results have implications for aging research as well as for clinical ooplasmic donation to rejuvenate aging oocytes. © Oxford University Press 2004; all rights reserved.

Access to Document (DOI)

The status, quality, and expansion of the NIH full-length cDNA project

Gerhard Daniela S., Wagner Lukas, Feingold Elise A., Shenmen Carolyn M., Grouse Lynette H., Schuler Greg, Klein Steven L., Old Susan, Rasooly Rebekah, Good Peter, Guyer Mark, Peck Allison M., Derge Jeffery G., Lipman David, Collins Francis S., Jang Wonhee, Sherry Steven, Feolo Mike, Misquitta Leonie, Lee Eduardo, Rotmistrovsky Kirill, Greenhut Susan F., Schaefer Carl F., Buetow Kenneth H., Bonner Tom I., Haussler David, Kent Jim, Diekhans Mark, Furey Terry, Brent Michael, Prange Christa, Schreiber Kirsten, Shapiro Nicole, Bhat Narayan K., Hopkins Ralph F., Hsie Florence, Driscoll Tom, Soares M. Bento, Bonaldo Maria F., Casavant Tom L., Scheetz Todd E., Brownstein Michael J., Usdin Ted B., Toshiyuki Shiraki, Carninci Piero, Piao Yulan, Dudekula Dawood B., Ko Minoru S H, Kawakami Koichi, Suzuki Yutaka, Sugano Sumio, Gruber C. E., Smith M. R., Simmons Blake, Moore Troy, Waterman Richard, Johnson Stephen L., Ruan Yijun, Lin Wei Chia, Mathavan S., Gunaratne Preethi H., Wu Jiaqian, Garcia Angela M., Hulyk Stephen W., Fuh Edwin, Yuan Ye, Sneed Anna, Kowis Carla, Hodgson Anne, Muzny Donna M., McPherson John, Gibbs Richard A., Fahey Jessica, Helton Erin, Ketteman Mark, Madan Anuradha, Rodrigues Stephanie, Sanchez Amy, Whiting Michelle, Madan Anup, Young Alice C., Wetherby Keith D., Granite Steven J., Kwong Peggy N., Brinkley Charles P., Pearson Russell L., Bouffard Gerard G., Blakesly Robert W., Green Eric D., Dickson Mark C., Rodriguez Alex C., Grimwood Jane, Schmutz Jeremy, Myers Richard M., Butterfield Yaron S N, Griffith Malachi, Griffith Obi L., Krzywinski Martin I., Liao Nancy, Morrin Ryan, Palmquist Diana, Petrescu Anca S., Skalska Ursula, Smailus Duane E., Stott Jeff M., Schnerch Angelique, Schein Jacqueline E., Jones Steven J M, Holt Robert A., Baross Agnes, Marra Marco A., Clifton Sandra, Makowski Kathryn A., Bosak Stephanie, Malek Joel

Genome Research 14 （ 10 B ） 2121 - 2127 2004年10月

ISSN 1088-9051

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. © 2004 by Cold Spring Harbor Laboratory Press.

Global gene expression analysis identifies molecular pathways distinguishing blastocyst dormancy and activation

Hamatani Toshio, Daikoku Takiko, Wang Haibin, Matsumoto Hiromichi, Carter Mark G., Ko Minoru S H, Dey Sudhansu K.

Proceedings of the National Academy of Sciences of the United States of America 101 （ 28 ） 10326 - 10331 2004年07月

ISSN 0027-8424

Delayed implantation (embryonic diapause) occurs when the embryo at the blastocyst stage achieves a state of suspended animation. During this period, blastocyst growth is very slow, with minimal or no cell division. Nearly 100 mammals in seven different orders undergo delayed implantation, but the underlying molecular mechanisms that direct this process remain largely unknown. In mice, ovariectomy before preimplantation ovarian estrogen secretion on day 4 of pregnancy initiates blastocyst dormancy, which normally lasts for 1-2 weeks by continued progesterone treatment, although blastocyst survival decreases with time. An estrogen injection rapidly activates blastocysts and initiates their implantation in the progesterone-primed uterus. Using this model, here we show that among ≈20,000 genes examined, only 229 are differentially expressed between dormant and activated blastocysts. The major functional categories of altered genes include the cell cycle, cell signaling, and energy metabolic pathways, particularly highlighting the importance of heparin-binding epidermal growth factor-like signaling in blastocyst-uterine crosstalk in implantation. The results provide evidence that the two different physiological states of the blastocyst, dormancy and activation, are molecularly distinguishable in a global perspective and underscore the importance of specific molecular pathways in these processes. This study has identified candidate genes that provide a scope for in-depth analysis of their functions and an opportunity for examining their relevance to blastocyst dormancy and activation in numerous other species for which microarray analysis is not available or possible due to very limited availability of blastocysts.

Access to Document (DOI)

A global view of gene expression in the preimplantation mouse embryo

Tanaka Tetsuya S., Ko Minoru S H

European Journal of Obstetrics Gynecology and Reproductive Biology 115 （ SUPPL. ） 2004年07月

ISSN 0301-2115

As a first step to understand preimplantation development, we performed global gene-expression profiling of morula and blastocyst using the NIA 15k mouse cDNA microarray. Gene expression levels were measured four times for blastocyst and five times for morula. Student's t-test at the 5% significance level identified 428 genes upregulated and 748 downregulated in blastocyst compared to morula. This trend was consistent with semi-quantative RT-PCR analysis of sample genes. The upregulated genes known to be involved in critical regulatory processes, included Mist1, Id2, Hd1, and Requiem; the downregulated genes included CREB-binding protein, Per3, zinc finger protein 217, Krox-25, and miwi1. Such well-characterized genes and many novel genes provide markers for early stages in development and starting materials for further functional studies.

Access to Document (DOI)

Gene content of the 750-kb critical region for mouse embryonic ectoderm lethal tcl-w5

Abe Kuniya, Yuzuriha Misako, Sugimoto Michihiko, Ko Minoru S H, Brathwaite Mgavi, Waeltz Paul, Nagaraja Ramaiah

Mammalian Genome 15 （ 4 ） 265 - 276 2004年04月

ISSN 0938-8990

Mice homozygous for the t^w5 allele arrest at gastrulation from defects associated with embryonic ectoderm development. The mutated gene has been genetically closely linked to the H-2K locus in the mouse MHC region, flanked by markers H-2Pb and D17Mit147. Aiming at the positional cloning of the mutated gene, we constructed a BAC contig spanning about 1 Mb of the genomic region. On the basis of our mapping and sequencing analysis of the BACs combined with public genome data, EST database searches, and gene prediction programs, we delimit the 1.06 cM of the t^w5 critical region to 750 kb, and infer 36 genes (1/20 kb) encoded in the interval. All of the 33 genes tested were confirmed as expressed in embryonic tissues by RT-PCR analyses, and in many cases by EST expression profiles as well. Thus, this highly gene-rich region is essentially totally transcribed during early development and provides priority candidates to be screened for the t^w5 embryonic lesion.

Access to Document (DOI)

Dynamics of global gene expression changes during mouse preimplantation development

Hamatani Toshio, Carter Mark G., Sharov Alexei A., Ko Minoru S H

Developmental Cell 6 （ 1 ） 117 - 131 2004年01月

ISSN 1534-5807

Understanding preimplantation development is important both for basic reproductive biology and for practical applications including regenerative medicine and livestock breeding. Global expression profiles revealed and characterized the distinctive patterns of maternal RNA degradation and zygotic gene activation, including two major transient waves of de novo transcription. The first wave corresponds to zygotic genome activation (ZGA); the second wave, named mid-preimplantation gene activation (MGA), precedes the dynamic morphological and functional changes from the morula to blastocyst stage. Further expression profiling of embryos treated with inhibitors of transcription, translation, and DNA replication revealed that the translation of maternal RNAs is required for the initiation of ZGA. We propose a cascade of gene activation from maternal RNA/protein sets to ZGA gene sets and thence to MGA gene sets. The large number of genes identified as involved in each phase is a first step toward analysis of the complex gene regulatory networks.

Access to Document (DOI)

Embryogenomics of pre-implantation mammalian development

Ko Minoru S H

Reproduction, Fertility and Development 16 （ 1-2 ） 79 - 85 2004年

ISSN 1031-3613

Pre-implantation development is marked by many critical molecular events, including the maternal to zygotic transition and the first differentiation of cells. Understanding such events is important, for both basic reproductive biology and practical applications, including regenerative medicine and livestock production. Scarcity of materials has hampered the progress of the field, but systematic genomics approaches are beginning to be applied to the study of pre-implantation development, resulting in unprecedented amounts of data about the pre-implantation process. The first step in embryogenomics is to collect and sequence cDNAs (expressed sequence tags (ESTs)) for genes that are expressed and function in these early embryos. Mouse work is the most advanced, with 140 111 ESTs derived from all stages of pre-implantation development currently available in the public sequence database. For other mammals, at present only approximately 1000 ESTs can be found in the public database, but efforts by several groups are generating cDNA libraries and ESTs. In the present review, the current status of the implementation of these investigative tools for mammalian pre-implantation embryos is discussed.

Aging of oocyte, ovary, and human reproduction

Ottolenghi Chris, Uda Manuela, Hamatani Toshio, Crisponi Laura, Garcia Jose Elias, Ko Minoru, Pilia Giuseppe, Sforza Chiarella, Schlessinger David, Forabosco Antonino

Annals of the New York Academy of Sciences 1034 117 - 131 2004年

ISSN 0077-8923

We review age-related changes in the ovary and their effect on female fertility, with particular emphasis on follicle formation, follicle dynamics, and oocyte quality. The evidence indicates that the developmental processes leading to follicle formation set the rules determining follicle quiescence and growth. This regulatory system is maintained until menopause and is directly affected in at least some models of premature ovarian failure (POF), most strikingly in the Foxl2 mouse knockout, a model of human POF with monogenic etiology (blepharophimosis/ptosis/epicanthus inversus syndrome). Several lines of evidence indicate that if the ovarian germ cell lineage maintains regenerative potential, as recently suggested in the mouse, a role in follicle dynamics for germ stem cells, if any, is likely indirect or secondary. In addition, age-related variations in oocyte quality in animal models suggest that reproductive competence is acquired progressively and might depend on parallel growth and differentiation of follicle cells and stroma. Genomewide analyses of the mouse oocyte transcriptome have begun to be used to systematically investigate the mechanisms of reproductive competence that are altered with aging. Investigative and therapeutic strategies can benefit from considering the role of continuous interactions between follicle cells and oocytes from the beginning of histogenesis to full maturation. © 2004 New York Academy of Sciences.

Access to Document (DOI)

The NIA cDNA project in mouse stem cells and early embryos

Carter Mark G., Piao Yulan, Dudekula Dawood B., Qian Yong, VanBuren Vincent, Sharov Alexei A., Tanaka Tetsuya S., Martin Patrick R., Bassey Uwem C., Stagg Carole A., Aiba Kazuhiro, Hamatani Toshio, Matoba Ryo, Kargul George J., Ko Minoru S H

Comptes Rendus - Biologies 326 （ 10-11 ） 931 - 940 2003年10月

ISSN 1631-0691

A catalog of mouse genes expressed in early embryos, embryonic and adult stem cells was assembled, including 250 000 ESTs, representing approximately 39 000 unique transcripts. The cDNA libraries, enriched in full-length clones, were condensed into the NIA 15 and 7.4K clone sets, freely distributed to the research community, providing a standard platform for expression studies using microarrays. They are essential tools for studying mammalian development and stem cell biology, and to provide hints about the differential nature of embryonic and adult stem cells. © 2003 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Access to Document (DOI)

Microarray analysis of somitogenesis reveals novel targets of different WNT signaling pathways in the somitic mesoderm

Buttitta Laura, Tanaka Tetsuya S., Chen Alice E., Ko Minoru S H, Fan Chen Ming

Developmental Biology 258 （ 1 ） 91 - 104 2003年06月

ISSN 0012-1606

WNT signaling plays a major role in patterning the dermomyotome of the somitic mesoderm. However, knowledge of downstream target genes and their regulation is limited. To identify new genes involved in the development and early patterning of the somite, we performed a comparison of gene expression by microarray between the presomitic mesoderm and the 5 most recently formed somites of the mouse at embryonic day 9.5. We identified 207 genes upregulated and 120 genes downregulated in somite formation. Expression analysis and functional categorization of these genes demonstrate this to be a diverse pool that provides a valuable resource for studying somite development. Thus far, we have found three genes expressed in the dermomyotome of the early somite. Consistent with their expression patterns, these genes are transcriptional targets of WNT signals, but display differential activation by different WNTs. We further demonstrate that 1 of these genes, Troy, is a direct target of canonical WNT signaling, while the other 2 genes, Selp and Arl4, are not. Thus, our microarray study using microdissected tissues not only provides global information on gene expression during somite development, it also provides novel targets to study the inductive signaling pathways that direct somite patterning. © 2003 Elsevier Science (USA). All rights reserved.

Access to Document (DOI)

Plac8 and Plac9, novel placental-enriched genes identified through microarray analysis

Galaviz-Hernandez Carlos, Stagg Carole, De Ridder Gustaaf, Tanaka Tetsuya S., Ko Minoru S H, Schlessinger David, Nagaraja Ramaiah

Gene 309 （ 2 ） 81 - 89 2003年05月

ISSN 0378-1119

Microarray expression profiling of a collection of 15,000 mouse genes with placental and embryonic RNAs revealed candidates for placental-enriched genes, three of which we have confirmed and further characterized. One, Plac1, strongly expressed in all trophoblast-derived cells in the placenta, has been described earlier (Genomics 68 (2000) 305). Here we report that of the other two, Plac8 expression is restricted to the spongiotrophoblast layer during development, whereas Plac9 is weakly expressed though highly enriched in placenta. For both, cDNAs with complete open reading frames were recovered and exon-intron structures inferred from comparisons of mouse cDNA and genomic sequence. The predicted proteins (112 and 108 amino acids) both contain putative signal peptides, with a coiled-coil segment of mPLAC9 as the only other detected motif. Genomic sequence comparisons reveal that in addition to an apparent pseudogene on chromosome 1, Plac8 is expressed at mouse cytoband 5e3. It is tightly conserved in human in a syntenically equivalent ortholog at 4q21.23. Plac9 is present in a single copy on chromosome 14, with a syntenically equivalent human ortholog at 10q22.3. Putative promoter regions up to 10 kb 5′ of the transcription units for Plac1, Plac8, and Plac9 contain sites for widely-expressed transcription factors which, by analogy to other instances, may be sufficient to explain placental enrichment. © 2003 Elsevier Science B.V. All rights reserved.

Access to Document (DOI)

In situ-synthesized novel microarray optimized for mouse stem cell and early developmental expression profiling

Carter Mark G., Hamatani Toshio, Sharov Alexei A., Carmack Condie E., Qian Yong, Aiba Kazuhiro, Ko Naomi T., Dudekula Dawood B., Brzoska Pius M., Hwang S. Stuart, Ko Minoru S H

Genome Research 13 （ 5 ） 1011 - 1021 2003年05月

ISSN 1088-9051

Applications of microarray technologies to mouse embryology/genetics have been limited, due to the nonavailability of microarrays containing large numbers of embryonic genes and the gap between microgram quantities of RNA required by typical microarray methods and the miniscule amounts of tissue available to researchers. To overcome these problems, we have developed a microarray platform containing in situ-synthesized 60-mer oligonucleotide probes representing approximately 22,000 unique mouse transcripts, assembled primarily from sequences of stem cell and embryo cDNA libraries. We have optimized RNA labeling protocols and experimental designs to use as little as 2 ng total RNA reliably and reproducibly. At least 98% of the probes contained in the microarray correspond to clones in our publicly available collections, making cDNAs readily available for further experimentation on genes of interest. These characteristics, combined with the ability to profile very small samples, make this system a resource for stem cell and embryogenomics research.

Access to Document (DOI)

Efficacy of 2-methoxyethoxy-modified antisense oligonucleotides for the study of mouse preimplantation development

Kimber Wendy L., Puri Nitin, Borgmeyer Carol, Ritter Donna, Sharov Alexei, Seidman Michael, Ko Minoru S H

Reproductive BioMedicine Online 6 （ 3 ） 318 - 322 2003年04月

ISSN 1472-6483

The advent of microarray technology, coupled with the availability of mouse cDNA collections derived specifically from preimplantation embryos, helps to provide global gene expression profiles for the earliest stages of development. However, to determine the functions of the large numbers of genes of interest, massive systematic functional assays such as gene 'knockdown' experiments are required. As a first step, the relative suppression of blastocyst formation by differentially-modified antisense oligonucleotides to E-cadherin was assayed. The injection of 2′-methoxyethoxy (2′-MOE)-modified oligonucleotides blocked the formation of blastocysts in two-thirds of embryos, whereas the injection of either control missense 2′-MOE-oligonucleotides, or oligonucleotides with a Morpholino modification, had no significant effect on embryonic development. Thus, the 2′-MOE-modified antisense oligonucleotides are candidates for effective examination of roles of large numbers of genes during early embryological development.

Probe design for large-scale molecular biology applications

VanBuren V., Yoshikawa T., Hamatani T., Ko M. S H

502 - 503 2003年

Large-scale molecular biology technologies such as DNA microarrays and large-scale in situ hybridization (ISH) are used to gain an appreciation of global attributes in biological tissues and cells. Although many of these efforts use cDNA probes, an approach that makes use of designed oligo probes should offer improved consistency at uniform hybridization conditions and improved specificity, as demonstrated by various oligo microarray platforms. We describe a new Web-based application that takes FASTA-formatted sequences as input, and returns both a list of the best choices for probes and a full report containing possible alternatives. Probe design for microarrays may use a scoring routine that optimizes probe intensity based upon an artificial neural network (ANN) trained to predict the average probe intensity from the physical properties of the probe and a screen for possible cross-reactivity. This new tool should provide a reliable way to construct probes that maximize signal intensity while minimizing cross-reactivity.

Access to Document (DOI)

Expression profiling of placentomegaly associated with nuclear transplantation of mouse ES cells

Suemizu Hiroshi, Aiba Kazuhiro, Yoshikawa Toshiyuki, Sharov Alexei A., Shimozawa Nobuhiro, Tamaoki Norikazu, Ko Minoru S H

Developmental Biology 253 （ 1 ） 36 - 53 2003年

ISSN 0012-1606

Transplantation of nuclei (NT) from engineered mouse ES cells is a potentially powerful and rapid route to create knockout mice, obviating the need for matings to obtain germ-line chimeras. However, such an application is currently impossible, because NT often results in abnormalities in embryo and placenta. Although the epigenetic instability of several imprinted genes in ES cells and ES-derived NT mice has been demonstrated, it is not clear yet what causes the abnormalities. To gain perspective on the extent and types of changes, we have done gene expression profiling for mouse placentas produced by NT of ES cells and compared them with the expression profiles of placentas produced by NT of one-cell embryos. Based on microarray studies with the NIA 15K mouse cDNA collection, we report five principal aberrant events: (1) inappropriate expression of imprinted genes; (2) altered expression of regulatory genes involved in global gene expression, such as DNA methyltransferase and histone acetyltransferase; (3) increased expression of oncogenes and growth promoting genes; (4) overexpression of genes involved in placental growth, such as Plac1; and (5) identification of many novel genes overexpressed in ES-derived NT mouse placentas, including Pitrm1, a new member of the metalloprotease family. The results indicate that placentomegaly in ES-derived NT mice is associated with large-scale dysregulation of normal gene expression patterns. The study also suggests the presence of two regulatory pathways that may lead to histologically discernable placentomegaly. The discovery of groups of genes with altered expression may provide potential targets for intervention to mimic natural regulation more faithfully in NT mice. © 2003 Elsevier Science (USA).

Access to Document (DOI)

Transcriptome analysis of mouse stem cells and early embryos

Sharov Alexei A., Piao Yulan, Matoba Ryo, Dudekula Dawood B., Qian Yong, VanBuren Vincent, Falco Geppino, Martin Patrick R., Stagg Carole A., Bassey Uwem C., Wang Yuxia, Carter Mark G., Hamatani Toshio, Aiba Kazuhiro, Akutsu Hidenori, Sharova Lioudmila, Tanaka Tetsuya S., Kimber Wendy L., Yoshikawa Toshiyuki, Jaradat Saied A., Pantano Serafino, Nagaraja Ramaiah, Boheler Kenneth R., Taub Dennis, Hodes Richard J., Longo Dan L., Schlessinger David, Keller Jonathan, Klotz Emily, Kelsoe Garnett, Umezawa Akihiro, Vescovi Angelo L., Rossant Janet, Kunath Tilo, Hogan Brigid L M, Curci Anna, D'Urso Michele, Kelso Janet, Hide Winston, Ko Minoru S H

PLoS Biology 1 （ 3 ） 2003年

ISSN 1544-9173

Understanding and harnessing cellular potency are fundamental in biology and are also critical to the future therapeutic use of stem cells. Transcriptome analysis of these pluripotent cells is a first step towards such goals. Starting with sources that include oocytes, blastocysts, and embryonic and adult stem cells, we obtained 249,200 high-quality EST sequences and clustered them with public sequences to produce an index of approximately 30,000 total mouse genes that includes 977 previously unidentified genes. Analysis of gene expression levels by EST frequency identifies genes that characterize preimplantation embryos, embryonic stem cells, and adult stem cells, thus providing potential markers as well as clues to the functional features of these cells. Principal component analysis identified a set of 88 genes whose average expression levels decrease from oocytes to blastocysts, stem cells, postimplantation embryos, and finally to newborn tissues. This can be a first step towards a possible definition of a molecular scale of cellular potency. The sequences and cDNA clones recovered in this work provide a comprehensive resource for genes functioning in early mouse embryos and stem cells. The nonrestricted community access to the resource can accelerate a wide range of research, particularly in reproductive and regenerative medicine.

Access to Document (DOI)

Gene expression profiling of embryo-derived stem cells reveals candidate genes associated with pluripotency and lineage specificity

Tanaka Tetsuya S., Kunath Tilo, Kimber Wendy L., Jaradat Saied A., Stagg Carole A., Usuda Masayuki, Yokota Takashi, Niwa Hitoshi, Rossant Janet, Ko Minoru S H

Genome Research 12 （ 12 ） 1921 - 1928 2002年12月

ISSN 1088-9051

Large-scale gene expression profiling was performed on embryo-derived stem cell lines to identify molecular signatures of pluripotency and lineage specificity. Analysis of pluripotent embryonic stem (ES) cells, extraembryonic-restricted trophoblast stem (TS) cells, and terminally-differentiated mouse embryo fibroblast (MEF) cells identified expression profiles unique to each cell type, as well as genes common only to ES and TS cells. Whereas most of the MEF-specific genes had been characterized previously, the majority (67%) of the ES-specific genes were novel and did not include known differentiated cell markers. Comparison with microarray data from embryonic material demonstrated that ES-specific genes were underrepresented in all stages sampled, whereas TS-specific genes included known placental markers. Investigation of four novel TS-specific genes showed trophoblast-restricted expression in cell lines and in vivo, whereas one uncharacterized ES-specific gene, Esg-1, was found to be exclusively associated with pluripotency. We suggest that pluripotency requires a set of genes not expressed in other cell types, whereas lineage-restricted stem cells, like TS cells, express genes predictive of their differentiated lineage.

Access to Document (DOI)

Assembly, verification, and initial annotation of the NIA mouse 7.4K cDNA clone set

VanBuren Vincent, Piao Yulan, Dudekula Dawood B., Qian Yong, Carter Carter G., Martin Patrick R., Stagg Carole A., Bassey Uwem C., Aiba Kazuhiro, Hamatani Toshio, Kargul George J., Luo Amber G., Kelso Janet, Hide Winston, Ko Minoru S H

Genome Research 12 （ 12 ） 1999 - 2003 2002年12月

ISSN 1088-9051

A set of 7407 cDNA clones (NIA mouse 7.4K) was assembled from >20 cDNA libraries constructed mainly from early mouse embryos, including several stem cell libraries. The clone set was assembled from embryonic and newborn organ libraries consisting of ∼120,000 cDNA clones, which were initially re-arrayed into a set of ∼11,000 unique cDNA clones. A set of tubes was constructed from the racks in this set to prevent contamination and potential mishandling errors in all further re-arrays. Sequences from this set (11K) were analyzed further for quality and clone identity, and high-quality clones with verified identity were re-arrayed into the final set (7.4K). The set is freely available, and a corresponding database was built to provide comprehensive annotation for those clones with known identity or homology, and has been made available through an extensive Web site that includes many link-outs to external databases and analysis servers.

Access to Document (DOI)

Identification, molecular characterization, and tissue expression of OVCOV1

Leach Richard E., Duniec-Dmuchowski Zofia M., Pesole Graziano, Tanaka Tetsuya S., Ko Minoru S H, Armant D. Randall, Krawetz Stephen A.

Mammalian Genome 13 （ 11 ） 619 - 624 2002年11月

ISSN 0938-8990

Key to the maternal-embryonic dialogue during early implantation are the extra embryonic trophoblast cells that play several critical roles including invasion of the maternal decidua. Cytotrophoblast proliferation and differentiation along an invasive pathway is regulated by a positive gradient of oxygen tension. We have employed transcript profiling to characterize the extra-embryonic tissues during early human implantation. We probed a cDNA library isolated from the ectoplacental cone region of stage 7.5 days post coitus mouse embryos with cDNA from hypoxic cultured human trophoblast cells. This identified the pattern of expression of a series of previously unknown genes that correlate to day 20 of human embryonic development. One EST was selected for further analysis since it is identical to the 1588-bp CGI-15 sequence assembled in silico. The human gene is organized into 10 exons 2063 bp in length. The open reading frame contains 1272 bp predicting protein composed of 365 amino acids. This gene is expressed in many tissues including those found in the reproductive tract. Its expression is regulated by oxygen tension and is unaffected by estradiol or progesterone treatment.

Access to Document (DOI)

EDA targets revealed by skin gene expression profiles of wild-type, Tabby and Tabby EDA-A1 transgenic mice

Cui Chang Yi, Durmowicz Meredith, Tanaka Tetsuya S., Hartung Andrew J., Tezuka Tadashi, Hashimoto Ken, Ko Minoru S H, Srivastava Anand K., Schlessinger David

Human Molecular Genetics 11 （ 15 ） 1763 - 1773 2002年07月

ISSN 0964-6906

Mutations in the EDA gene cause anhidrotic ectodermal dysplasia (EDA), with lesions in skin appendage formation. To begin to analyze EDA pathways, we have used expression profiling on 15 000-gene mouse cDNA microarrays, comparing adult mouse skin from wild-type, EDA-defective (Tabby) mice, and Tabby mice supplemented with the EDA-A1 isoform, which is sufficient to rescue multiple Tabby phenotypes. Given the sensitivity of the current microarray system, 8500 genes (60%) were estimated to be expressed, including transcription factors and growth-regulatory genes that had not previously been identified in skin; but only 24 (0.16%), one-third of them novel, showed significant differences between wild type and Tabby. An additional eight genes not included in the 15 000 gene set were shown to have expression differences by real-time RT-PCR. Sixteen of 32 affected genes were restored significantly toward wild-type levels in EDA-A1 transgenic Tabby mice. Significant up-regulation in Tabby skin was observed for several dermal matrix genes, including Col1a1, Col1a2, Col3a1 and Sparc. In contrast, down-regulation occurred for the NEMO/NF-kB pathway, already implicated in skin appendage formation, and even more markedly for a second pathway, JNK/c-jun/c-fos and their target genes, that has not previously been clearly associated with skin development. These data are consistent with the regulation of the NF-kB pathway by EDA, and support its involvement in the regulation of the JNK pathway as well.

Evaluation and comparison of clustering algorithms in analyzing ES cell gene expression data

Chen Gengxin, Jaradat Saied A., Banerjee Nila, Tanaka Tetsuya S., Ko Minoru S H, Zhang Michael Q.

Statistica Sinica 12 （ 1 ） 241 - 262 2002年01月

ISSN 1017-0405

Many clustering algorithms have been used to analyze microarray gene expression data. Given embryonic stem cell gene expression data, we applied several indices to evaluate the performance of clustering algorithms, including hierarchical clustering, k-means, PAM and SOM. The indices were homogeneity and separation scores, silhouette width, redundant score (based on redundant genes), and WADP (testing the robustness of clustering results after small perturbation). The results showed that the ES cell dataset posed a challenge for cluster analysis in that the clusters generated by different methods were only partially consistent. Using this data set, we were able to evaluate the advantages and weaknesses of algorithms with respect to both internal and external quality measures. This study may provide a guideline on how to select suitable clustering algorithms and it may help raise issues in the extraction of meaningful biological information from microarray expression data.

Embryogenomics

Ko Minoru S H

Trends in Biotechnology 19 （ 12 ） 511 - 518 2001年12月

ISSN 0167-7799

Fundamental questions in developmental biology are: what genes are expressed, where and when they are expressed, what is the level of expression and how are these programs changed by the functional and structural alteration of genes? These questions have been addressed by studying one gene at a time, but a new research field that handles many genes in parallel is emerging. The methodology is at the interface of large-scale genomics approaches and developmental biology. Genomics needs developmental biology because one of the goals of genomics - collection and analysis of all genes in an organism - cannot be completed without working on embryonic tissues in which many genes are uniquely expressed. However, developmental biology needs genomics - the high-throughput approaches of genomics generate information about genes and pathways that can give an integrated view of complex processes. This article discusses these new approaches and their applications to mammalian developmental biology.

Access to Document (DOI)

Assignment of OVCOV1 (alias CGI-15) to human chromosome 20 band q13.1→q13.2 by fluorescent in situ hybridization

Leach Richard, Duniec-Dmuchowski Z., Tanaka T., Ko M. S., Krawetz S. A.

Cytogenetics and Cell Genetics 94 （ 3-4 ） 252 - 253 2001年

ISSN 0301-0171

Genetic mapping and functional studies of a natural inhibitor of the insulin receptor tyrosine kinase

Cintrón V. J., Ko M. S., Chi K. D., Gross J. P., Srinivas P. R., Goustin A. S., Grunberger G.

International journal of experimental diabetes research 1 （ 4 ） 249 - 263 2001年

ISSN 1560-4284

Fetuin/alpha2-HS glycoprotein (alpha2-HSG) homologs have been identified in several species including rat, sheep, pig, rabbit, guinea pig, cattle, mouse and human. Multiple physiological roles for these homologs have been suggested, including ability to bind to hydroxyapatite crystals and to specifically inhibit the tyrosine kinase (TK) activity of the insulin receptor (IR). In this study we report the identification, cloning, and characterization of the mouse Ahsg gene and its function as an IR-TK inhibitor. Genomic clones derived from a mouse Svj 129 genomic library were sequenced in order to characterize the intron-exon organization of the mouse Ahsg gene, including an 875 bp subclone containing 154 bp upstream from the transcription start site, the first exon, and part of the first intron. A second genomic subclone harboring a 3.45 kb Bgl II fragment contained exons 2, 3 and 4 in addition to two adjacent elements within the first intron-a repetitive element of the B1 family (92 bp) and a 271 bp tract of (T,C)n*(A,G)n. We have mapped mouse Ahsg at 16 cM adjacent to the Diacylglycerol kinase 3 (Dagk3) gene on chromosome 16 by genotyping interspecific backcross panels between C57BL/6J and Mus spretus. The position is syntenic with human chromosome 3q27, where the human AHSG gene resides. Using recombinant mouse alpha2-HSG expressed from a recombinant baculovirus, we demonstrate that mouse alpha2-HSG inhibits insulin-stimulated IR autophosphorylation and IR-TKA in vitro. In addition, mouse alpha2-HSG (25 microg/ml) completely abolishes insulin-induced DNA synthesis in H-35 rat hepatoma cells. Based on the sequence data and functional analysis, we conclude that the mouse Ahsg gene is the true ortholog of the human AHSG gene.

Verification and initial annotation of the NIA mouse 15K cDNA clone set

Kargul G. J., Dudekula D. B., Qian Y., Lim M. K., Jaradat S. A., Tanaka T. S., Carter M. G., Ko M. S H

Nature Genetics 28 （ 1 ） 17 - 18 2001年

ISSN 1061-4036

Access to Document (DOI)

A murine dopamine neuron-specific cDNA library and microarray

Barrett Tanya, Xie Tao, Piao Yulan, Dillon-Carter Ora, Kargul George J., Lim Meng K., Chrest Francis J., Wersto Robert, Rowley Daniel L., Juhaszova Magdalena, Zhou Li, Vawter Marquis P., Becker Kevin G., Cheadle Christopher, Wood William H., McCann Una D., Freed William J., Ko Minoru S., Ricaurte George A., Donovan David M.

Neurobiology of Disease 8 （ 5 ） 822 - 833 2001年

ISSN 0969-9961

Due to brain tissue heterogeneity, the molecular genetic profile of any neurotransmitter-specific neuronal subtype is unknown. The purpose of this study was to purify a population of dopamine neurons, construct a cDNA library, and generate an initial gene expression profile and a microarray representative of dopamine neuron transcripts. Ventral mesencephalic dopamine neurons were purified by fluorescent-activated cell sorting from embryonic day 13.5 transgenic mice harboring a 4.5-kb rat tyrosine hydroxylase promoter-lacZ fusion. Nine-hundred sixty dopamine neuron cDNA clones were sequenced and arrayed for use in studies of gene expression changes during methamphetamine neurotoxicity. A neurotoxic dose of methamphetamine produced a greater than twofold up-regulation of the mitochondrial cytochrome c oxidase polypeptide I transcript from adult mouse substantia nigra at 12 h posttreatment. This is the first work to describe a gene expression profile for a neuronal subtype and to identify gene expression changes during methamphetamine neurotoxicity. © 2001 Academic Press.

Access to Document (DOI)

Construction of long-transcript enriched cDNA libraries from submicrogram amounts of total RNAs by a universal PCR amplification method

Piao Y., Ko N. T., Lim M. K., Ko M. S H

Genome Research 11 （ 9 ） 1553 - 1558 2001年

ISSN 1088-9051

Here we report a novel design of linker primer that allows one to differentially amplify long tracts (average 3.0 kb with size ranges of 1-7 kb) or short DNAs (average 1.5 kb with size ranges of 0.5-3 kb) from a complex mixture. The method allows one to generate cDNA libraries enriched for long transcripts without size selection of insert DNAs. One representative library from newborn kidney includes 70% of clones bearing ATG start codons. A comparable library has been generated from 20 mouse blastocysts, containing only ∼40 ng of total RNA. This universal PCR amplification scheme can provide a route to isolate very large cDNAs, even if they are expressed at very low levels.

Access to Document (DOI)

A radiation hybrid map of mouse genes

Hudson Thomas J., Church Deanna M., Greenaway Simon, Nguyen Huy, Cook April, Steen Robert G., Van Etten William J., Castle Andrew B., Strivens Mark A., Trickett Pamela, Heuston Christine, Davison Claire, Southwell Anne, Hardisty Rachel, Varela-Carver Anabel, Haynes Andrew R., Rodriguez-Tome Patricia, Doi Hirofumi, Ko Minoru S H, Pontius Joan, Schriml Lynn, Wagner Lukas, Maglott Donna, Brown Steve D M, Lander Eric S., Schuler Greg, Denny Paul

Nature Genetics 29 （ 2 ） 201 - 205 2001年

ISSN 1061-4036

A comprehensive gene-based map of a genome is a powerful tool for genetic studies and is especially useful for the positional cloning and positional candidate approaches. The availability of gene maps for multiple organisms provides the foundation for detailed conserved-orthology maps showing the correspondence between conserved genomic segments. These maps make it possible to use cross-species information in gene hunts and shed light on the evolutionary forces that shape the genome. Here we report a radiation hybrid map of mouse genes, a combined project of the Whitehead Institute/Massachusetts Institute of Technology Center for Genome Research, the Medical Research Council UK Mouse Genome Centre, and the National Center for Biotechnology Information. The map contains 11,109 genes, screened against the T31 RH panel and positioned relative to a reference map containing 2,280 mouse genetic markers. It includes 3,658 genes homologous to the human genome sequence and provides a framework for overlaying the human genome sequence to the mouse and for sequencing the mouse genome.

Access to Document (DOI)

Random monoallelic expression of three genes clustered within 60 kb of mouse t complex genomic DNA

Sano Yuri, Shimada Tokihiko, Nakashima Hiroshi, Nicholson Rhonda H., Eliason James F., Kocarek Thomas A., Ko Minoru S H

Genome Research 11 （ 11 ） 1833 - 1841 2001年

ISSN 1088-9051

Mammals achieve gene dosage control by (1) random X-chromosome inactivation in females, (2) parental origin-specific imprinting of selected autosomal genes, and (3) random autosomal inactivation. Genes belonging to the third category of epigenetic phenomenon are just now emerging, with only six identified so far. Here we report three additional genes, Nubp2, Igfals, and Jsap1, that show 50%-methylated CpG sites by Southern blot analyses and primarily monoallelic expression in single-cell allele-specific RT-PCR analysis of bone marrow stromal cells and hepatocytes. Furthermore, we show that, in contrast to X inactivation, alleles can switch between active and inactive states during the formation of daughter cells. These three genes are the first in their category to exist as a tight cluster, in the proximal region of mouse chromosome 17, providing a thus far unique example of a region of autosomal random monoallelic expression.

PLAC1, an Xq26 gene with placenta-specific expression

Cocchia Massimo, Huber Reid, Pantano Serafino, Chen Ellson Y., Ma Peter, Forabosco Antonino, Ko Minoru S H, Schlessinger David

Genomics 68 （ 3 ） 305 - 312 2000年09月

ISSN 0888-7543

A novel human X-linked gene shows placenta-specific expression and has been named PLAC1. The gene maps 65 kb telomeric to HPRT at Xq26 and has been completely sequenced at the cDNA and genomic levels. The mouse orthologue Plac1 maps to the syntenically equivalent region of the mouse X chromosome. In situ hybridization studies with the antisense mRNA during mouse embryogenesis detect Plac1 expression from 7.5 dpc (days postcoitum) to 14.5 dpc in ectoplacental cone, giant cells, and labyrinthine trophoblasts. The putative human and murine PLAC1 proteins are 60% identical and 77% homologous. Both include a signal peptide and a peptide sequence also found in an interaction domain of the ZP3 (zona pellucida 3) protein. These results make PLAC1 a marker for placental development, with a possible role in the establishment of the mother-fetus interface. (C) 2000 Academic Press.

Access to Document (DOI)

Phemx, a novel mouse gene expressed in hematopoietic cells maps to the imprinted cluster on distal chromosome 7

Nicholson Rhonda H., Pantano Serafino, Eliason James F., Galy Anne, Weiler Sarah, Kaplan Joseph, Hughes Mark R., Ko Minoru S H

Genomics 68 （ 1 ） 13 - 21 2000年08月

ISSN 0888-7543

Phemx (Pan hematopoietic expression) is a novel murine gene expressed in developmentally regulated sites of hematopoiesis from early in embryogenesis through adulthood. Phemx is expressed in hematopoietic progenitors and mature cells of the three main hematopoietic lineages. Conceptual translation of the murine Phemx cDNA predicts a 25-kDa polypeptide with four hydrophobic regions and several potential phosphorylation sites, suggestive of a transmembrane protein involved in cell signaling. The PHEMX protein is structurally similar to tetraspanin CD81 (TAPA-1), a transmembrane protein involved in leukocyte activation, adhesion, and proliferation. Phemx maps to the distal region of chromosome 7, a segment of the mouse genome that contains a cluster of genes that exhibit genomic imprinting. However, imprinting analysis of Phemx at the whole organ level shows that it is biallelically expressed, suggesting that mechanisms leading to monoallelic expression are not imposed at this locus. The human PHEMX ortholog is specifically expressed in hematopoietic organs and tissues and, in contrast to murine Phemx, undergoes alternative splicing. The unique mode and range of Phemx expression suggest that it plays a role in hematopoietic cell function. (C) 2000 Academic Press.

Access to Document (DOI)

Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray

Tanaka Tetsuya S., Jaradat Saied A., Lim Meng K., Kargul George J., Wang Xiaohong, Grahovac Marija J., Pantano Serafino, Sano Yuri, Piao Yulan, Nagaraja Ramaiah, Doi Hirofumi, Wood William H., Becker Kevin G., Ko Minoru S H

Proceedings of the National Academy of Sciences of the United States of America 97 （ 16 ） 9127 - 9132 2000年08月

ISSN 0027-8424

cDNA microarray technology has been increasingly used to monitor global gene expression patterns in various tissues and cell types. However, applications to mammalian development have been hampered by the lack of appropriate cDNA collections, particularly for early developmental stages. To overcome this problem, a PCR-based cDNA library construction method was used to derive 52,374 expressed sequence tags from pre- and peri-implantation embryos, embryonic day (E) 12.5 female gonad/mesonephros, and newborn ovary. From these cDNA collections, a microarray representing 15,264 unique genes (78% novel and 22% known) was assembled. In initial applications, the divergence of placental and embryonic gene expression profiles was assessed. At stage E12.5 of development, based on triplicate experiments, 720 genes (6.5%) displayed statistically significant differences in expression between placenta and embryo. Among 289 more highly expressed in placenta, 61 placenta-specific genes encoded, for example, a novel prolactin-like protein. The number of genes highly expressed (and frequently specific) for placenta has thereby been increased 5-fold over the total previously reported, illustrating the potential of the microarrays for tissue-specific gene discovery and analysis of mammalian developmental programs.

Access to Document (DOI)

Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development

Ko Minoru S H, Kitchen John R., Wang Xiaohong, Threat Tracy A., Wang Xueqian, Hasegawa Aki, Sun Tong, Grahovac Marija J., Kargul George J., Lim Meng K., Cui YuShun, Sano Yuri, Tanaka Tetsuya, Liang Yuling, Mason Scott, Paonessa Paul D., Sauls Althea D., DePalma Grace E., Sharara Rana, Rowe Lucy B., Eppig Janan, Morrell Chris, Doi Hirofumi

Development 127 （ 8 ） 1737 - 1749 2000年04月

ISSN 0950-1991

Little is known about gene action in the preimplantation events that initiate mammalian development. Based on cDNA collections made from each stage from egg to blastocyst, 25438 3'-ESTs were derived, and represent 9718 genes, half of them novel. Thus, a considerable fraction of mammalian genes is dedicated to embryonic expression. This study reveals profound changes in gene expression that include the transient induction of transcripts at each stage. These results raise the possibility that development is driven by the action of a series of stage-specific expressed genes. The new genes, 798 of them placed on the mouse genetic map, provide entry points for analyses of human and mouse developmental disorders.

Interferon-γ receptor polymorphisms determine strain differences in accessibility of activated lymphocyte NK-triggering antigens to recognition by self-reactive NK cells

Chou Shan Rong, Brownell Amy, Ko Minoru S H, Kaplan Joseph

Cellular Immunology 200 （ 2 ） 88 - 97 2000年03月

ISSN 0008-8749

The 'NK-triggering-antigen regulator' (Nktar) gene is a locus identified in the C57BL/6 genome which regulates the ability of unlabeled activated Con A blasts to compete for recognition of labeled syngeneic Con A blasts by BALB/c NK cells. Linkage analysis on Con A blasts from (BALB/c x CByB6F1) N2 backcross progeny for (1) relative level of competitive inhibition of BALB/c NK lysis of syngeneic Con A blasts and (2) genotypes at polymorphic microsatellite markers distributed throughout the mouse genome mapped the Nktar gene locus to a 5-cM region of chromosome 10 containing the interferon- γ receptor (Ifngr) gene locus. N2 Con A blasts exhibited an inverse relationship between (a) their cell surface density of IFN-γR molecules detected by FACS with monoclonal anti-CD119 and (b) their cold target inhibition of BALB/c NK self-reactivity. Con A blasts from Ifngr(-1-) knockout mice showed a relatively high level of inhibition of BALB/c NK self- lysis and a relatively low level of class I MHC, which were both reversed by transient transfection with the Ifngr gene. Sequencing studies showed that Balb/c Ifngr encodes a Gly⁶⁹ whereas C57BL/6 Ifngr encodes Glu⁶⁹ due to a difference at nucleotide 284. Sequencing studies of N2 progeny demonstrated 100% concordance between their Nktar inhibitory phenotype and their Ifngr genotype. These findings demonstrate that the Nktar and Ifngr loci are identical. They further indicate that polymorphisms related to the Ifngr locus and affecting expression of cell surface IFN-γR may underlie genetic differences in the availability of NK-triggering antigens (NKTAgs) to recognition by self-reactive BALB/c NK cells by differentially affecting the ability of IFN-γ/R molecules to mediate up-regulation of NKTAg-masking class I molecules. (C) 2000 Academic Press.

Access to Document (DOI)

Eleven densely clustered genes, six of them novel, in 176 kb of mouse t-complex DNA

Kargul George J., Nagaraja Ramaiah, Shimada Tokihiko, Grahovac Marija J., Lim Meng K., Nakashima Hiroshi, Waeltz Paul, Ma Peter, Chen Ellson, Schlessinger David, Ko Minoru S H

Genome Research 10 （ 7 ） 916 - 923 2000年

ISSN 1088-9051

Targeted sequencing of the mouse t-complex has started with a 176-kb, gene-rich BAC localized with six PCR-based markers in inversion 2/3 of the highly duplicated region. The sequence contains 11 genes recovered primarily as cDNAs from early embryonic collections, including Igfals (previously placed on chromosome 17), Nubp2 (a fully characterized gene), Jsap1 (a JNK-binding protein), Rsp29 (the mouse homologue of the rat gene), Ndk3 (a nucleoside diphosphate kinase), and six additional putative genes of unknown function. With 50% GC content, 75% of the DNA transcribed, and one gene/16.0 kb (on average), the region may qualify as one of the most gene-dense segments in the mouse genome and provides candidates for dosage-sensitive phenotypes and mouse embryonic lethals mapped to the vicinity.

Access to Document (DOI)

The beta subunit of the high-affinity IgE receptor, a candidate for atopic dermatitis, is not imprinted [1]

Yotsumoto S., Kanzaki T., Ko M. S H

British Journal of Dermatology 142 （ 2 ） 370 - 371 2000年

ISSN 0007-0963

Access to Document (DOI)

Two novel mouse genes - Nubp2, mapped to the t-complex on chromosome 17, and Nubp1, mapped to chromosome 16 - Establish a new gene family of nucleotide-binding proteins in eukaryotes

Nakashima Hiroshi, Grahovac Marija J., Mazzarella Richard, Fujiwara Hiroyuki, Kitchen John R., Threat Tracy A., Ko Minoru S H

Genomics 60 （ 2 ） 152 - 160 1999年09月

ISSN 0888-7543

Two novel mouse genes and one novel human gene that define distinctive eukaryotic nucleotide-binding proteins (NUBP) and are related to the mrp gene of prokaryotes are characterized. Phylogenetic analyses of the genes, encoding a short form (Nubp2) and a long form (Nubp1) of NUBP, clearly establish them as a new NUBP/MRP gene family that is well conserved throughout phylogeny. In addition to conserved ATP/GTP-binding motifs A (P- loop) and A', members of this family share at least two highly conserved sequence motifs, NUBP/MRP motifs α and β. Only one type of NUBP/MRP gene has been observed thus far in prokaryotes, but there are two types in eukaryotes. One group includes mouse Nubp1, human NBP, yeast NBP35, and Caenorhabditis elegans F10G8.6 and is characterized by a unique N-terminal sequence with four cysteine residues that is lacking in the other group, which includes mouse Nubp2, human NUBP2, and yeast YIA3w. Northern blot analyses of the two mouse genes show distinctive patterns consistent with this classification. Mouse Nubp2 is mapped to the t-complex region of mouse Chromosome 17, whereas Nubp1 is mapped to the proximal region of mouse Chromosome 16. Interestingly, both regions are syntenic with human chromosome 16p13.1-p13.3, suggesting that a chromosomal breakage between Nubp2 and Nubp1 probably occurred during the evolution of mouse chromosomes.

Access to Document (DOI)

Assignment of amyloid-precursor-like protein 2 gene (APLP2) to 11q24 by fluorescent in situ hybridization

Leach Richard E., Ko M., Krawetz S. A.

Cytogenetics and Cell Genetics 87 （ 3-4 ） 215 - 216 1999年

ISSN 0301-0171

Erratum

Jaradat S. A., Ko M. S H, Grossman L. I.

Genomics 54 （ 3 ） 583 - 584 1998年12月

ISSN 0888-7543

Expression of adrenomedullin, a hypotensive peptide, in the trophoblast giant cells at the embryo implantation site in mouse

Yotsumoto Shinichi, Shimada Tokihiko, Cui Chang Yi, Nakashima Hiroshi, Fujiwara Hiroyuki, Ko Minoru S H

Developmental Biology 203 （ 2 ） 264 - 275 1998年11月

ISSN 0012-1606

Adrenomedullin (AM) is a newly discovered hypotensive peptide which is believed to play an important role for blood pressure control in the adult. Although it has been well established that a major production site of AM is vascular endothelial cells, we now show that AM is most highly expressed in trophoblast giant cells, which are derived from the conceptus and are directly in contact with maternal tissues at the implantation site. Northern blot and in situ hybridization analyses show that the AM mRNA begins to be detected just after implantation and its level peaks at 9.5 days postconception (d.p.c.) in those cells. Expression then falls dramatically after 10.5 d.p.c., coincident with the completion of the mature chorioallantoic placenta. Immunohistochemical analyses show that the AM peptide is secreted from the trophoblast giant cells into the surrounding tissues, i.e., embryo, decidua, and maternal circulation. In contrast, the expression of an AM receptor was not detected by Northern blot analyses in either embryo or trophoblast giant cells at 7 d.p.c., when the AM gene is most highly expressed in the trophoblast giant cells. This suggests that the AM produced and secreted from the embryo's trophoblast giant cells acts on the maternal tissues rather than on the embryonic tissues. Based on these results, we propose that the high production of AM may be the mechanism by which the embryos survive at the early postimplantation period by pooling maternal blood in the implantation site in order to secure nutrition and oxygen before the establishment of efficient embryo-maternal circulation through the mature placenta.

Access to Document (DOI)

Genome-wide mapping of unselected transcripts from extraembryonic tissue of 7.5-day mouse embryos reveals enrichment in the t-complex and under-representation on the X chromosome

Ko Minoru S H, Threat Tracy A., Wang Xueqian, Horton Joseph H., Cui Yushun, Wang Xiaohong, Pryor Eric, Paris Jason, Wells-Smith Jeannine, Kitchen John R., Rowe Lucy B., Eppig Janan, Satoh Toshihiko, Brant Larry, Fujiwara Hiroyuki, Yotsumoto Shinichi, Nakashima Hiroshi

Human Molecular Genetics 7 （ 12 ） 1967 - 1978 1998年11月

ISSN 0964-6906

Mammalian embryos can only survive if they attach to the uterus (implantation) and establish proper maternal-fetal interactions. To understand this complex implantation pathway, we have initiated genomic analysis with a systematic study of the cohort of genes expressed in extraembryonic cells that are derived from the conceptus and play a major role in this process. A total of 2103 cDNAs from the extraembryonic portion of 7.5-day post-conception mouse embryos yielded 3186 expressed sequence tags, ~40% of which were novel to the sequence databases. Furthermore, when 155 of the cDNA clones with no homology to previously detected genes were genetically mapped, apparent clustering of these expressed genes was detected in subregions of chromosomes 2, 7, 9 and 17, with 6.5% of the observed genes localized in the t-complex region of chromosome 17, which represents only ~1.5% of the mouse genome. In contrast, X-linked genes were under-represented. Semi-quantitative RT-PCR analyses of the mapped genes demonstrated that one third of the genes were expressed solely in extraembryonic tissue and an additional one third of the genes were expressed predominantly in the extraembryonic tissues. The over-representation of extraembryonic-expressed genes in dosage-sensitive autosomal imprinted regions and under-representation on the dosage-compensated X chromosome may reflect a need for tight quantitative control of expression during development.

Access to Document (DOI)

Developmental genomics and its relation to aging

Schlessinger David, Ko Minoru S H

Genomics 52 （ 1 ） 113 - 118 1998年08月

ISSN 0888-7543

Access to Document (DOI)

Tissue-specific expression and mapping of the Cox7ah gene in mouse

Jaradat Saied A., Ko Minoru S H, Grossman Lawrence I.

Genomics 49 （ 3 ） 363 - 370 1998年05月

ISSN 0888-7543

We have isolated and examined the gene for the heart isoform of cytochrome c oxidase subunit VIIa (COX VIIa-H) in mouse, an isoform gene previously thought to be lacking in rodents. Interspecies amino acid comparisons indicate that mouse COX VIIa-H protein displays 82.5 and 70.9% identity with the bovine and human heart isoforms of COX VIIa, but only 53.7% identity with the paralogous mouse liver isoform (COX VIIa-L). Expression in adult mouse tissues is limited to heart and skeletal muscle, as found in other species. In the early mouse embryo, Cox7al was the exclusive isoform expressed and Cox7ah mRNA was not detectable until day 17 postcoitum. That the mouse Cox7ah gene characterized in this study is orthologous to the human COX7AH gene was also suggested by its mapping to mouse chromosome 7, to a conserved region syntenic with the human chromosome location of COX7AH, 19q13.1. As a result, all three COX heart isoform genes in mouse group to chromosome 7. Interestingly, mapping of the mouse Cox7al to chromosome 9 suggests a new syntenic region between the mouse and the human genomes.

Access to Document (DOI)

A systematic molecular genetic approach to study mammalian germline development

Abe Kuniya, Ko Minoru S H, Macgregor Grant R.

International Journal of Developmental Biology 42 （ 7 ） 1051 - 1065 1998年

ISSN 0214-6282

It is difficult to study gene expression in mammalian embryonic germ cells as PGCs constitute only a minor proportion of the mouse embryo. We have overcome this problem by using a novel combination of established molecular and transgenic approaches. A line of mice has been generated in which the cells of the germ lineage express the β-galactosidase reporter gene during embryogenesis. Using this line, germ cells have been purified to near homogeneity from embryos at discrete stages during germline development by use of a stain for β-gal activity and a fluorescence activated cell sorter. Subsequently, cDNA libraries have been constructed from each germ cell population using a modified lone-linker PCR strategy. These combined cDNA libraries represent genes expressed in PGCs during mammalian germline development. To facilitate a molecular genetic approach to studying mammalian germline development, these cDNA libraries will be pooled to form an arrayed, addressed reference embryonic germ cell cDNA library. In parallel with large- scale cDNA sequencing efforts, genes that are differentially expressed in germ cells will be identified by screening the reference library with probes generated by subtractive hybridization. Complementary DNAs identified using this approach will be analyzed by sequencing, database comparison, genomic mapping and in situ hybridization to ascertain the potential functional importance of each gene to germline development. In addition to providing a wealth of novel information regarding patterns of gene expression during mammalian germline development, these results will form the basis for future experiments to determine the function of these genes in this process.

The Tabby phenotype is caused by mutation in a mouse homologue of the EDA gene that reveals novel mouse and human exons and encodes a protein (ectodysplasin-A) with collagenous domains

Srivastava Anand K., Pispa Johanna, Hartung Andrew J., Du Yangzhu, Ezer Sini, Jenks Ted, Shimada Tokihiko, Pekkanen Maija, Mikkola Marja L., Ko Minoru S H, Thesleff Irma, Kere Juha, Schlessinger David

Proceedings of the National Academy of Sciences of the United States of America 94 （ 24 ） 13069 - 13074 1997年11月

ISSN 0027-8424

Mouse Tabby (Ta) and X chromosome-linked human EDA share the features of hypoplastic hair, teeth, and eccrine sweat glands. We have cloned the T(a) gene and find it to be homologous to the EDA gene. The gene is altered in two Ta alleles with a point mutation or a deletion. The gene is expressed in developing teeth and epidermis; no expression is seen in corresponding tissues from Ta mice. Ta and EDA genes both encode alternatively spliced forms; novel exons now extend the 3' end of the EDA gene. All transcripts recovered have the same 5' exon. The longest Ta cDNA encodes a 391-residue transmembrane protein, ectodysplasin-A, containing 19 Gly-Xaa-Yaa repeats. The isoforms of ectodysplasin-A may correlate with differential roles during embryonic development.

Access to Document (DOI)

Differential expression pattern of XqPAR-linked genes SYBL1 and IL9R correlates with the structure and evolution of the region

D'Esposito Maurizio, Matarazzo Maria Rosaria, Ciccodicola Alfredo, Strazzullo Maria, Mazzarella Richard, Quaderi Nandita A., Fujiwara Hiroyuki, Ko Minoru S H, Rowe Lucy B., Ricco Angela, Archidiacono Nicoletta, Rocchi Mariano, Schlessinger David, D'Urso Michele

Human Molecular Genetics 6 （ 11 ） 1917 - 1923 1997年10月

ISSN 0964-6906

The recently discovered second pseudoautosomal region (XqPAR) contains at least two genes, IL9R and SYBL1. Recent findings show that, like XpPAR genes, IL9R escapes X inactivation and its Y allele is also expressed, but SYBL1 seems to act like an X-linked gene, expressed from the active X chromosome but not from the inactive X or Y. Here we show that differences are also seen in the evolution of the sex chromosome locations of IL9R and SYBL1, IL9R is known to be autosomal in mice, and is X-linked only in primates. SYBL1, however, has been found to be on the X chromosome in all mammals tested, from marsupials to humans. Both genes were duplicated on the Y homologue of the terminal portion of the X chromosome during the evolution of Homo sapiens from other higher primates. The inactivation pattern of SYBL1 may be correlated with its longer history of X linkage, and at a more centromeric chromosomal position during evolution; the more recent X linkage and more telomeric position of the IL9R gene may explain its autosomal, 'uninactivated' transcriptional status.

Access to Document (DOI)

Basal cell carcinoma occurring in multiple familial trichoapithelloma

Harada H., Hashimoto K., Toi Y., Yotsumoto S., Ko M. S H

Archives of Dermatology 133 （ 5 ） 666 - 667 1997年

ISSN 0003-987X

Cloning and expression analyses of mouse dystroglycan gene

Yotsumoto Shinichi, Fujiwara Hiroyuki, Horton Joseph H., Mosby Tracy A., Wang Xueqian, Cui Yushun, Ko Minoru S H

Human Molecular Genetics 5 （ 9 ） 1259 - 1267 1996年09月

ISSN 0964-6906

While constructing a catalog of mouse cDNAs which are expressed in the maternal-fetal interface during the peri-implantation period, we encountered a 1.6 kb cDNA clone showing a strong sequence similarity to the 3' untranslated region of the human dystroglycan gene. We cloned an additional 1.7 kb cDNA by reverse transcriptase-PCR (RT-PCR) and confirmed that this is a true mouse homolog of human dystroglycan cDNA by sequence analyses, Southern blotting, and genetic mapping of this gene on the distal region of mouse chromosome 9. Although it is well established that dystroglycan, a transmembrane protein, plays an important role in muscle tissues by bridging intracellular dystrophin to the laminin in the extracellular matrix, its role in non-muscle tissues remains elusive. To further investigate the role of the dystroglycan gene at the peri-implantation stage, we analyzed the expression patterns of this gene by in situ hybridization, which revealed that this gene is specifically expressed in decidual cells, especially in the cells surrounding the implantation site at 6.5, 7.5, and 8.5 day post conception (p.c.) stages, but not expressed in non-pregnant endometrial cells of uterus nor in the decidua at 12.5 day p.c. Further analyses by RT-PCR confirmed that the amount of dystroglycan mRNA in 8.5 day p.c. decidua was indeed 100-fold higher than that of non-pregnant uterus and 12.5 day p.c. mature placenta. These results suggest that dystroglycan may work as a mediator for adhesion between decidual cells themselves or between decidual cells and trophoblast cells, and provide a structural and functional support for maintaining pregnancy at its early stage.

Access to Document (DOI)

Expression of aryl hydrocarbon receptor mRNA in porcine retina

Singh A. K., Ko M. S H, Shichi H.

Investigative Ophthalmology and Visual Science 37 （ 3 ） 1996年02月

ISSN 0146-0404

Purpose. The aryl hydrocarbon receptor (AHR) mediates CYP1A1/1A2 induction by aryl hydrocarbons (e.g. TCDD). AHR proteins are similar to steroid receptors in their mechanism of action but constitute a distinct molecular family (1). In addition to a role in drug metabolism, it was suggested that AHR may regulate the homeostasis and cell differentiation (2). Two Drosophila proteins Sim and Per which are homologous to AHR appear to play roles in neural development and circadian rhythm, respectively. AHR may also have a function in mammalian retina. In this study, therefore, we investigated whether AHR mRNA is expressed in porcine retina. Methods. cDNA was synthesized from porcine retina RNA by RT-PCR using primers designed from mouse AHR cDNA and cloned into pCR^TM II vector. DNA was sequenced with SP6 and T7 primers and analyzed by NCBI BLAST Search. Results. From a comparison of 341 bases, the porcine retina PCR product was found to be very similar to AHR from several species [rat (R), mouse (M), human (H), sheep (S)]. Hog: ACATAACGGACGAAATCCTGACCCGGTTGCAGAA R: -------A--------------GTACG-----G- (- , identical residue) M: -------G---------------TACG-----G-Hog: GTCATAGCTATTCTGTGTGAATGTATATACATTCACACAGAATAGCTATGAC H: ---------G------------------------------------------S: ------------------------------------------C---------Conclusions. AHR message is expressed in porcine retina. In the eye CYP1A1/1A2 induction is highest in the ciliary epithelium and negligible in the retina (3). Then, the question is: What is AHR doing in the retina?.

The gene for multiple familial trichoepithelioma maps to chromosome 9p21

Harada Hiroshi, Hashimoto Ken, Ko Minoru S H

Journal of Investigative Dermatology 107 （ 1 ） 41 - 43 1996年

ISSN 0022-202X

Multiple familial trichoepithelioma (MFT) is an autosomal dominant skin disease characterized by the presence of many small tumors predominantly on the face. To map the causative gene, we performed linkage analysis with microsatellite markers in three American families. We found a significant linkage of a gene for MFT to chromosome 9p21. The maximum combined lod score was 3.31 at D9S171 at θ = 0. The disease locus was defined to a 4-cM region between IFNA and D9S126. Because several tumor suppressor genes including p16 and p15 have been mapped to this region, the gene for MFT may also be a tumor suppressor.

Toward a Whole cDNA Catalog

Takahashi Naomi, Ko Minoru S H

Genomics 23 （ 1 ） 202 - 210 1994年09月

ISSN 0888-7543

The construction of a cDNA library containing all genes without redundancy is one of the major technical challenges for biology. Toward this goal, we have developed an equalized (normalized) cDNA library from mRNA pools derived from mouse embryos that cover the entire period of mouse ontogenesis. Colony hybridization analyses with 11 genes showed the reduction of abundance variation from at least 6000-fold in the unequalized S-library to ∼33-fold in the EIII-library, which was constructed after three cycles of equalization procedure. Limiting dilution PCR analyses with 26 tissue-specific genes showed the reduction of abundance variation from at least ∼1,000,000-fold in the S-cDNA mixture to ∼100-fold in the EIII-cDNA mixture. Based on these analyses, we estimate that at least 15,000 independent cDNA clones are included with little redundancy in the EIII-cDNA library. This will be a useful resource for mouse biology as well as the mouse genome project. © 1994 Academic Press. All rights reserved.

Access to Document (DOI)

Genetic mapping of 40 cDNA clones on the mouse genome by PCR

Ko M. S H, Wang X., Horton J. H., Hagen M. D., Takahashi N., Maezaki Y., Nadeau J. H.

Mammalian Genome 5 （ 6 ） 349 - 355 1994年06月

ISSN 0938-8990

We recently proposed a new PCR-based genetic marker assay for the mouse genome that exploits sequence differences in the 3′-untranslated region (UTR) of cDNAs between different mouse strains, called "biallelic polymorphic expressed sequence tags (bESTs)." The specific use of 3′-UTR has several advantages: (1) frequent sequence polymorphism between different mouse strains, (2) most commonly uninterrupted by introns, (3) usually unique sequence even among closely related gene family members. In this paper, we identify additional genetic loci defined by bEST and determine their location on the mouse genetic map by using interspecific backross mapping panels between C57BL/6J and Mus spretus. Of 136 markers tested, 86 produced unique PCR products from C57BL/6J and M. spretus genomic DNAs. We then sequenced these 86 PCR products from C57BL/6J and M. spretus and found that 59 markers have sequence polymorphisms. Of these, we mapped 36 by restriction fragment length polymorphism (RFLP) of the PCR products and 4 by length polymorphism (LP) of the PCR products. We discuss the possibility of a large-scale application of this method for cDNA mapping. © 1994 Springer-Verlag New York Inc.

Access to Document (DOI)

Maps from two interspecific backcross DNA panels available as a community genetic mapping resource

Rowe L. B., Nadeau J. H., Turner R., Frankel W. N., Letts V. A., Eppig J. T., Ko M. S H, Thurston S. J., Birkenmeier E. H.

Mammalian Genome 5 （ 5 ） 253 - 274 1994年05月

ISSN 0938-8990

We established two mouse interspecific backcross DNA panels, one containing 94 N2 animals from the cross (C57BL/6J × Mus spretus)F₁ × C57BL/6J, and another from 94 N2 animals from the reciprocal backcross (C57BL/6J × SPRET/Ei)F₁ × SPRET/Ei. We prepared large quantities of DNA from most tissues of each animal to create a community resource of interspecific backcross DNA for use by laboratories interested in mapping loci in the mouse. Initial characterization of the genetic maps of both panels has been completed. We used MIT SSLP markers, proviral loci, and several other sequence-defined genes to anchor our maps to other published maps. The BSB panel map (from the backcross to C57BL/6J) contains 215 loci and is anchored by 45 SSLP and 32 gene sequence loci. The BSS panel map (from the backcross to SPRET/Ei) contains 451 loci and is anchored by 49 SSLP loci, 43 proviral loci, and 60 gene sequence loci. To obtain a high density of markers, we used motif-primed PCR to "fingerprint" the panel DNAs. We constructed two maps, each representing one of the two panels. All new loci can be located with a high degree of certainty on the maps at current marker density. Segregation patterns in these data reveal several examples of transmission ratio distortion and permit analysis of the distribution of crossovers on individual chromosomes. © 1994 Springer-Verlag New York Inc.

Access to Document (DOI)

Simple and robust screening of pooled yeast artificial chromosome libraries by the restriction enzyme digestion of polymerase chain reaction products

Wang X., Qian J., Ko M. S H

Genetic Analysis Techniques and Applications 11 （ 3 ） 63 - 68 1994年

ISSN 1050-3862

The polymerase chain reaction (PCR)-based method for screening pooled yeast artificial chromosome (YAC) libraries was modified by adding a step for the restriction enzyme digestion of the PCR products. This modification significantly increased the reliability of YAC screening and made it possible to identify YAC clones without a cumbersome verification step by colony hybridization and/or Southern blotting. Using this method, we assigned 39 mouse YAC clones to a mouse genetic map with 13 biallelic, polymorphic expressed sequence tags. This method provides a fast, reliable way to identify YAC clones with PCR-based sequence-tagged sites.

Access to Document (DOI)

Optimized conditions for cycle sequencing of PCR products

Horton J. H., Hagen M. D., Ko M. S H

PCR Methods and Applications 3 （ 6 ） 359 - 360 1994年

ISSN 1054-9803

The Short 3′-End Region of Complementary DNAs as PCR-Based Polymorphic Markers for an Expression Map of the Mouse Genome

Takahashi Naomi, Ko Minoru S H

Genomics 16 （ 1 ） 161 - 168 1993年04月

ISSN 0888-7543

Ideal markers for a complementary DNA (cDNA) map of the mouse genome should be amplifiable by the polymerase chain reaction (PCR) and they should be polymorphic for genetic mapping, as well as unique for physical mapping. In our search for such markers, we did comparative sequencing of PCR-amplified genomic DNAs derived from 15 inbred strains and found that about 250 bp of the 3′-end region (3′-ER) of cDNAs, which is the sequence immediately upstream from the poly(A) tail, was polymorphic enough to distinguish the allele of a laboratory strain from that of a wild strain (Mus spretus) in 14 of 22 cDNAs tested. Specifically, in 9 of these 14 cDNAs, each allele was identified by the restriction fragment length polymorphism. This data indicates that about 65% of the 3′-ERs of cDNAs can be automatically transformed into PCR-based genetic markers named "biallelic polymorphic expressed sequence tags (bESTs)." These markers can be easily and precisely mapped by typing of the panels of interspecific backcrosses. Because a large number of bEST markers can be efficiently obtained by a single-run automated sequencing of randomly selected cDNAs, these markers will greatly facilitate the construction of high-resolution genetic and physical maps of expressed sequences of the mouse genome. © 1993 Academic Press. All rights reserved.

Access to Document (DOI)

An equalized cDNA library and its application

Ko M. S.

Tanpakushitsu kakusan koso. Protein, nucleic acid, enzyme 38 （ 3 ） 420 - 428 1993年02月

ISSN 0039-9450

Induction mechanism of a single gene molecule

Ko Minoru S H

BioEssays 14 （ 5 ） 341 - 346 1992年

ISSN 0265-9247

A new field of gene expression regulation research is emerging that has previously been overlooked. This new area is concerned with distinguishing the expression of a single gene from the averaged expression of many gene copies within the cell population. This paper reviews research focused on individual genes in inducible gene expression systems. The main experimental strategy is to measure the gene expression level of a single cell containing a single reporter gene molecule. In contrast to the commonly held belief, gene induction is found to be stochastic under certain conditions. The possible mechanisms and implications are discussed.

A stochastic model for gene induction

Ko Minoru S H

Journal of Theoretical Biology 153 （ 2 ） 181 - 194 1991年11月

ISSN 0022-5193

Expression levels of individual copies of an inducible gene have been presumed to be identical to the averaged level of many copies and to change in a smooth and predictable way according to the concentration of an inducing molecule. However, our recent experiments using a steroid-inducible system showed that the expression levels of individual copies are very heterogeneous and do not necessarily coincide with the averaged expression level of many copies (Ko et al., 1990, EMBO J. 9, 2835-2842). To explain this result, I present a stochastic model for gene induction here and its analysis using computer simulation. Stochasticity in the model is derived from the randomness corresponding to the random timing of molecular collisions and dissociations between transcription factors and a gene copy, since at any instant each copy is thought to be either "switched on" by having a transcription complex bound to it, or "switched off' by not having a transcription complex bound. This model can produce two types of gene induction that depend on the stability of the transcription complex on the regulatory region of the gene. An unstable transcription complex causes a homogeneous level of gene induction among individual copies, while a stable transcription complex causes a heterogeneous level. Since the recent consensus formed by in vitro transcription experiments is that the transcription complex is generally very stable, the latter case (the non-deterministic one) is highly possible. Since typical eukaryotic cells have just two copies for any gene in a single cell, this possibility of heterogeneous gene induction indicates that the phenotypes of individual cells cannot be precisely determined by just environmental signals, such as inducers. This may prompt us to reconsider many problems related to gene induction, including morphogenesis. © 1991 Academic Press Limited.

Access to Document (DOI)

An 'equalized cDNA library' by the reassociation of short double-stranded cDNAs

Ko Minoru S H

Nucleic Acids Research 18 （ 19 ） 5705 - 5711 1990年10月

ISSN 0305-1048

The total number of genes in higher organisms is estimated to be under one hundred thousand. However, constructing a cDNA library containing a full set of genes expressed throughout the life time of an organism, without redundancy, is a major challenge for modern biology. Towards this goal, I have tried to make a library of mouse fibroblastoid LtK^- cells with nearly equal representations of cDNA clones. Double-stranded cDNAs (ds-cDNAs) are synthesized from mRNA using an oligo(dT)-Notl primer. After shearing to 200-400 bp, a synthetic linker-primer, which has one blunt and one sticky end and an internal EcoRI site, is ligated to the cDNAs. The cDNAs are amplified by the polymerase chain reaction (PCR) using the ligated linker-primer sequence. After denaturation and reassociation of the ds-cDNAs, and isolation of single-stranded cDNAs (ss-cDNAs) by hydroxylapatite chromatography, the ss-cDNAs are again amplified by PCR. The cDNAs are digested with EcoRI and Notl, and inserted into a plasmid vector. Colony hybridization with eight probes of different abundance showed a reduction in 'abundance variation' from at least 20,000-fold in the original library to 40-fold in the library constructed after three cycles of equalization. This indicates the usefulness of the current procedure for making equalized cDNA libraries.

Unbiased amplification of a highly complex mixture of DNA fragments by 'lone linker'-tagged PCR

Ko M. S H, Ko S. B H, Takahashi N., Nishiguchi K., Abe K.

Nucleic Acids Research 18 （ 14 ） 4293 1990年07月

ISSN 0305-1048

Access to Document (DOI)

The dose dependence of glucocorticoid-inducible gene expression results from changes in the number of transcriptionally active templates

Ko Minoru S H, Nakauchi Hiromitsu, Takahashi Naomi

EMBO Journal 9 （ 9 ） 2835 - 2842 1990年

ISSN 0261-4189

Glucocorticoid hormones induce the transcription of genes having glucocorticoid response elements in a dose dependent manner. To determine whether this dose dependence represents a response of individual templates or of the mass of templates, we introduced a bacterial β-galactosidase gene linked to the glucocorticoid-indudble enhancer/promoter of the mouse mammary tumor virus (MTV) into Ltk^- cells and obtained stable transformants containing a single or a few templates per cell. Visual inspection and flow cytometry analysis by enzyme histochemistry assay for β-galactosidase revealed that individual cells showed very heterogeneous β-galactosidase activity after 48 h induction with dexamethasone. When the glucocorticoid concentration was increased, an increasing cell population producing β-galactosidase was observed. These phenomena were probably not due to heterogeneity of template copy number or to a predetermined cellular state among individual cells, since cells forming a single small colony gave similar results. This was also supported by data showing that recloned cells retained both their responsiveness to the glucocorticoid hormone and their digestion pattern in Southern blotting analyses. These results indicate that the dose dependent increase of glucocorticoid-inducible gene expression is caused by an increase in the number of transcriptionally active templates.

An auto-inducible vector conferring high glucocorticoid inducibility upon stable transformant cells

Ko Minoru S H, Naomi Takahashi, Norifumi Sugiyama, Toshiya Takano

Gene 84 （ 2 ） 383 - 389 1989年12月

ISSN 0378-1119

A new gene expression system in mammalian cells was developed by using the glucocorticoid receptor (GR) as an inducible positive feedback factor. Mouse Ltk^- cells were transfected with plasmids carrying the GR-encoding gene and the lacZ reporter gene, both of which were fused with the glucocorticoid-inducible enhancer/promotor of the mouse mammary tumor virus (MTV). The GR gene was first induced to supply the receptor protein, which further induced the expression of both GR and reporter genes. Stable transformants induced with dexamethasone, a synthetic glucocorticoid hormone, demonstrated β-galactosidase activity 60-140-fold higher than uninduced controls. Similarly, the human α-interferon-encoding gene fused with the MTV enhancer/promoter was induced more than 12 000-fold. This system allowed us to increase the expression of the reporter or target genes without augmenting basal levels of expression significantly, and may be useful to investigate the unknown function of a cloned gene, particularly when the gene product of interest is cytotoxic or growth-inhibiting. © 1989.

Access to Document (DOI)

A highly inducible system of gene expression by positive feedback production of glucocorticoid receptors

Ko M. S H, Takano T.

DNA 8 （ 2 ） 127 - 133 1989年

ISSN 0198-0238

Sarcoma viruses carrying ras oncogenes induce differentiation-associated properties in a neuronal cell line

Noda Makoto, Ko Minoru, Ogura Akihiko, Liu Ding Gan, Amano Takehiko, Takano Toshiya, Ikawa Yoji

Nature 318 （ 6041 ） 73 - 75 1985年

ISSN 0028-0836

The growth-promoting and/or differentiation-blocking activities of Kirsten (Ki-MSV) or Harvey murine sarcoma virus (Ha7-MSV) on various types of cells in vitro are well documented^1-8. Here we report an unexpected effect of these viruses on a rat phaeochromocytoma cell line, PC12. PC12 cells, which multiply indefinitely in growth medium, are known to respond to nerve growth factor (NGF) by cessation of cell division and expression of several properties resembling those of differentiated sympathetic neurones^9,10. We have found that Ki- and Ha-MSV mimic some, if not all, of the activities of NGF in PC12 cells, and there is evidence that the viral oncogenes, v-Ki-ras and v-Ha-ras, are responsible for this phenomenon. This system may be of value for studying the mechanism of action of the v-ras genes as well as the regulatory mechanism of growth and differentiation in neuronal cells. © 1985 Nature Publishing Group.

Access to Document (DOI)

　前のページ - 次のページ　

洪 実

論文 - 洪 実

洪　実

論文 - 洪　実